An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'id:QT-eve-ST*'
ID   QT-EVE-ST-001; SV 0; linear; genomic DNA; STS; SYN; 134 BP.
XX
AC   BPS-25271-9;
XX
DT   05-MAR-2010
DT   14-OCT-2010
XX
DE   Quantitative PCR method for detection of potato event EH92-527-1
DE   (Savini et al., 2006).
XX
KW   event_specific.
XX
OS   Solanum tuberosum (potato) - event EH92-527-1 (BPS-25271-9)
XX
RN   [1]
RP   1-134
RA   Savini C., Foti N., Mazzara M., Charles Delobel C., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Event EH92-527-1 Potato Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Potato";
RL   Online Publication (2006).
RX   DOI=10.2788/30418
XX
RN   [2]
RP   1-134
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ST-001.pdf
XX
DR   GMOMETHODS; QT-TAX-ST-010;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..134
FT                   /standard_name="PCR 134 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of potato event EH92-527-1 and the potato host genome"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: Event527-bf1"
FT                   /note="GTGTCAAAACACAATTTACAGCA"
FT                   /target="insert"
FT   primer_bind     complement(86..110)
FT                   /standard_name="RT-PCR probe: St527-S2"
FT                   /note="FAM-AGATTGTCGTTTCCCGCCTTCAGTT-TAMRA"
FT   primer_bind     complement(113..134)
FT                   /standard_name="Primer reverse: St527-R1"
FT                   /note="TCCCTTAATTCTCCGCTCATGA"
FT                   /target="3'-host genome"
XX
SQ   Sequence 134 BP; 28 A; 12 C; 18 G; 12 T; 64 other;
     gtgtcaaaac acaatttaca gcannnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnaactg aaggcgggaa acgacaatct nntcatgagc       120
     ggagaattaa ggga                                                         134
//