ID QL-ELE-00-004; SV 0; linear; genomic DNA; STS; SYN; 123 BP. XX AC ; XX DT 23-JUN-2009 DT 04-OCT-2010 XX DE Qualitative PCR method for detection of Cauliflower Mosaic Virus 35S promoter DE (Lipp et al.,2001). XX KW element_specific. XX RN [1] RP 1-123 RA Lipp M., Bluth A., Eyquem F., Kruse L., Schimmel H., Van den Eede G., RA Anklam E.; RT "Validation of a method based on polymerase chain reaction for the RT detection of genetically modified organisms in various processed RT foodstuffs"; RL Eur. Food Res. Technol. 212:497-504 (2001). RX DOI=10.1007/s002170000274 XX RN [2] RP 1-123 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Qualitative nucleic acid based RT methods"; RL ISO 21569:1-69 (2005). RX ISO=34614 XX RN [3] RP 1-123 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-ELE-00-004.pdf XX FH Key Location/Qualifiers FH FT STS 1..123 FT /standard_name="PCR 123 bp amplicon" FT /note="element-specific PCR" FT /target="Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)" FT primer_bind 1..21 FT /standard_name="Primer forward: 35S-cf3" FT /note="CCACGTCTTCAAAGCAAGTGG" FT /target="CaMV P-35S" FT primer_bind complement(99..123) FT /standard_name="Primer reverse: 35S-cr4" FT /note="TCCTCTCCAAATGAAATGAACTTCC" FT /target="CaMV P-35S" XX SQ Sequence 123 BP; 35 A; 30 C; 25 G; 33 T; 0 other; ccacgtcttc aaagcaagtg gnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnngg aagttcattt catttggaga 120 gga 123 //