ID QT-ELE-00-002; SV 0; linear; genomic DNA; STS; SYN; 68 BP. XX AC ; XX DT 23-JUN-2009 DT 20-SEP-2010 XX DE Quantitative PCR method for detection of phosphinothricin N-acetyltransferase gene DE (Weighard et al., 2004). XX KW element_specific. XX RN [1] RP 1-68 RA Weighardt F., Barbati C., Paoletti C., Querci M., Kay S., De Beuckeleer RA M., Van den Eede G.; RT "Real-time polymerase chain reaction-based approach for quantification of RT the pat gene in the T25 Zea mays event"; RL J AOAC Int 87:1342-1355 (2004). RX PUBMED; 15675446. XX RN [2] RP 1-68 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-ELE-00-002.pdf XX FH Key Location/Qualifiers FH FT STS 1..68 FT /standard_name="PCR 68 bp amplicon" FT /note="element-specific RT-PCR" FT /target="Phosphinothricin N-acetyltransferase (pat) gene from Streptomyces viridochromogenes" FT primer_bind 1..21 FT /standard_name="Primer forward: KVM-5" FT /note="TTGAGGGTGTTGTGGCTGGTA" FT /target="pat" FT primer_bind complement(23..44) FT /standard_name="RT-PCR probe: Pat1" FT /note="FAM-CTTCCAGGGCCCAGCGTAAGCA-TAMRA" FT primer_bind complement(48..68) FT /standard_name="Primer reverse: KVM-6" FT /note="TGTCCAATCGTAAGCGTTCCT" FT /target="pat" XX SQ Sequence 68 BP; 12 A; 12 C; 25 G; 19 T; 0 other; ttgagggtgt tgtggctggt antgcttacg ctgggccctg gaagnnnagg aacgcttacg 60 attggaca 68 //