ID QL-TAX-ZM-002; SV 1; linear; genomic DNA; STD; PLN; 84 BP. XX AC ; XX DT 03-JUN-1988 DT 29-FEB-2016 XX DE Qualitative PCR method for detection of maize alcoholdeydrogenase 1 gene (Barbau-Piednoir et al., 2014). XX KW taxon_specific, validated_in_combination. XX OS Zea mays (maize) XX RN [1] RP 1-84 RA Barbau-Piednoir E., Stragier P., Roosens N., Mazzara M., Van den Eede G., RA Van den Bulcke M.; RT "Inter-laboratory Testing of GMO Detection by Combinatory SYBR Green PCR RT Screening(CoSYPS)"; RL Food Analitical Methods 0:0-0 (2014). RX DOI=10.1007/s12161-014-9837-3 XX RN [2] RP 1-84 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2014). RX PCR=QL-TAX-ZM-002.pdf XX RN [3] RP 1-84 RT "See Cross-references below"; RL Online Publication (2014). XX DR GMOMETHODS; QL-ELE-00-017; DR GMOMETHODS; QL-ELE-00-018; DR GMOMETHODS; QL-ELE-00-019; DR GMOMETHODS; QL-ELE-00-020; DR GMOMETHODS; QL-ELE-00-021; DR GMOMETHODS; QL-ELE-00-022; XX FH Key Location/Qualifiers FH FT STS 1..84 FT /standard_name="PCR 84 bp amplicon" FT /note="taxon-specific PCR for maize" FT /target="alcohol dehydrogenase 1 (adh1) gene" FT primer_bind 1..27 FT /standard_name="Primer forward: ADH_alt Fwd" FT /note="TCTCTTCCTCCTTTAGAGCTACCACTA" FT /target="adh1" FT primer_bind complement(64..84) FT /standard_name="Primer reverse: ADH_alt Rev" FT /note="AATCGATCCAAAGCGAGATGA" FT /target="adh1" XX SQ Sequence 84 BP; 16 A; 26 C; 12 G; 30 T; 0 other; tctcttcctc ctttagagct accactannn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnntcatctc gctttggatc gatt 84 //