ID QT-TAX-ST-010; SV 0; linear; genomic DNA; STS; PLN; 89 BP. XX AC ; XX DT 27-JUN-2008 DT 28-OCT-2010 XX DE Quantitative PCR method for detection of potato UDP-glucose pyrophosphorylase gene DE (Savini et al., 2006). XX KW taxon_specific, validated_in_combination. XX OS Solanum tuberosum (potato) XX RN [1] RP 1-89 RA Savini C., Foti N., Mazzara M., Charles Delobel C., Van Den Eede G.; RT "Event-specific Method for the Quantification of Event EH92-527-1 Potato Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Potato"; RL Online Publication (2006). RX DOI=10.2788/30418 XX RN [2] RP 1-89 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QT-EVE-ST-001; XX FH Key Location/Qualifiers FH FT gene 1..89 FT /gene="UGPase" FT /allele="Lemhi10" FT STS complement(1..89) FT /standard_name="PCR 88 bp amplicon" FT /note="taxon-specific RT-PCR for potato" FT /target="UDP-glucose pyrophosphorylase (UGPase) gene" FT primer_bind 1..21 FT /standard_name="Primer forward: UGP-af7" FT /note="GGACATGTGAAGAGACGGAGC" FT /target="UGPase" FT primer_bind complement(36..62) FT /standard_name="RT-PCR probe: UGP-sf1" FT /note="FAM-CTACCACCATTACCTCGCACCTCCTCA-TAMRA" FT primer_bind complement(70..89) FT /standard_name="Primer reverse: UGP-ar8" FT /note="CCTACCTCTACCCCTCCGC" FT /note="Based on the sequence coming FT from GenBank record with accession number U20345, between FT the 17th and 18th nucleotide of the reverse primer (C and G, respectively) is FT expected an additional nucleotide A. In the CRL dossier FT concerning GMO event EH92-527-1 potato this 2250th FT nucleotide of the GenBank sequence is deleted" FT /target="UGPase" XX SQ Sequence 89 BP; 18 A; 5 C; 35 G; 10 T; 21 other; ggacatgtga agagacggag cnnnnnnnnn nnnnntgagg aggtgcgagg taatggtggt 60 agnnnnnnng cnggaggggt agaggtagg 89 //