ID QT-TAX-GM-002; SV 0; linear; genomic DNA; STS; PLN; 74 BP. XX AC ; XX DT 29-MAY-2009 DT 24-AUG-2016 XX DE Quantitative PCR method for detection of soybean lectin gene XX KW taxon_specific, validated_in_combination. XX OS Glycine max (soybean) XX RN [1] RP 1-74 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [2] RP 1-74 RA Mazzara M., Munaro B., Larcher S., Grazioli E., Charles Delobel C., Savini C., Van Den Eede G.; RT "Event-specific Method for the Quantification of Soybean Line 40-3-2 RT Using Real-time PCR - Validation Report and Protocol - Report on the RT Validation of a DNA Extraction Method for Soybean Seeds. RL Online Publication (2007). RX DOI=10.2788/61824 XX RN [3] RP 1-74 RA Charles Delobel C., Bogni A., Pinski G., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Soybean Line MON89788 - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/44579 XX RN [4] RP 1-74 RA Mazzara M., Munaro B., Grazioli E., Savini C., Charles Delobel C., Van Den Eede G.; RT "Event-specific Method for the Quantification of Soybean Event DP-356043-5 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2009). RX DOI=10.2788/5751 XX RN [5] RP 1-74 RA Mazzara M., Munaro B., Grazioli E., Savini C., Charles Delobel C., Van Den Eede G.; RT "Event-specific Method for the Quantification of Soybean Event DP-305423-1 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2009). RX DOI=10.2788/57423 XX RN [6] RP 1-74 RA Delobel C., Mazzara M., Grazioli E., Van den Eede G.; RT "Event-specific Method for the Quantification of Soybean MON87701 by Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2011). RX DOI=10.2788/38101 XX RN [7] RP 1-74 RA Savini C., Mazzara M., Pinski G., Van den Eede G.; RT "Event-specific Method for the Quantification of Soybean CV127 by Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2011). RX DOI=10.2788/37626 XX RN [8] RP 1-74 RA Mazzara M., Delobel C., Pinski G., Savini C., Van den Eede G.; RT "Event-specific Method for the Quantification of Soybean MON87769 Using Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2012). RX DOI=10.2788/4544 XX RN [9] RP 1-74 RA Savini C.,Mazzara M., Delobel C., Pinski G., Van den Eede G.; RT "Event-specific Method for the Quantification of Soybean MON87705 Using Real-time PCR - Validation Report and Validated Method RL Online Publication (2012). RX DOI=10.2788/48383 XX RN [10] RP 1-74 RA Savini C., Mazzara M., Munaro B., Kreysa J.; RT "Event-specific Method for the Quantification of Soybean MON87708 Using Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2013). RX DOI=10.2788/90943 XX RN [11] RP 1-74 RA Savini C., Sacco M.G., Mazzara M., Kreysa J.; RT "Event-specific Method for the Quantification of Soybean DAS-68416-4 Using Real-time PCR. Validation Report and Validated Method"; RL Online Publication (2014). RX DOI=10.2788/87396 XX RN [12] RP 1-74 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Soybean DAS-81419-2 by Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2015). RX EURL_GMFF=EURLVL0313VR%20Soybean%20DAS-81419-2%20.pdf RX EURL_GMFF=EURLVL0313VP_Validated%20method.pdf XX RN [13] RP 1-74 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Soybean DAS-44406-6 by Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2015). RX EURL_GMFF=EURL-VL-0112%20VR_Final.pdf RX EURL_GMFF=EURL-VL-01-12_VP_Final.pdf XX RN [14] RP 1-74 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Soybean MON 87751 Using Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2016). RX EURL_GMFF=EURL-VL-03-14-VR.pdf RX EURL_GMFF=MON-87751-Validated-Method.pdf XX RN [15] RP 1-74 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR - JRC Validated Methods, Reference Methods and Measurements Reports"; RL Online Publication (2016). RX EURL_GMFF=EURL-VL-04-12-VR.pdf RX EURL_GMFF=EURL-VL-04-12-VP.pdf XX RN [16] RP 1-74 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QT-CON-00-003; DR GMOMETHODS; QT-EVE-GM-005; DR GMOMETHODS; QT-EVE-GM-006; DR GMOMETHODS; QT-EVE-GM-009; DR GMOMETHODS; QT-EVE-GM-008; DR GMOMETHODS; QT-EVE-GM-010; DR GMOMETHODS; QT-EVE-GM-011; DR GMOMETHODS; QT-EVE-GM-002; DR GMOMETHODS; QT-EVE-GM-003; DR GMOMETHODS; QT-EVE-GM-012; DR GMOMETHODS; QT-EVE-GM-013; DR GMOMETHODS; QT-EVE-GM-014; DR GMOMETHODS; QT-EVE-GM-015; DR GMOMETHODS; QT-EVE-GM-016; DR GMOMETHODS; QT-EVE-GM-017; XX FH Key Location/Qualifiers FH FT STS 1..74 FT /standard_name="PCR 74 bp amplicon" FT /note="taxon-specific RT-PCR for soybean" FT /target="lectin (Le1) gene" FT primer_bind 1..20 FT /standard_name="Primer forward: GM1-F" FT /note="CCAGCTTCGCCGCTTCCTTC" FT /target="Le1" FT primer_bind 23..46 FT /standard_name="RT-PCR probe: GM1" FT /note="FAM-CTTCACCTTCTATGCCCCTGACAC-TAMRA" FT primer_bind complement(52..74) FT /standard_name="Primer reverse: GM1-R" FT /note="GAAGGCAAGCCCATCTGCAAGCC" FT /target="Le1" XX SQ Sequence 74 BP; 14 A; 27 C; 13 G; 20 T; 0 other; ccagcttcgc cgcttccttc nncttcacct tctatgcccc tgacacnnnn nggcttgcag 60 atgggcttgc cttc 74 //
