ID QT-TAX-GM-007; SV 0; linear; genomic DNA; STS; PLN; 118 BP. XX AC ; XX DT 15-SEP-2009 DT 21-SEP-2010 XX DE Quantitative PCR method for detection of soybean lectin gene XX KW taxon_specific, validated_in_combination. XX OS Glycine max (soybean) XX RN [1] RP 1-118 RA Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., RA Akiyama H., Goda Y., Toyoda M., Hino A.; RT "Validation of real-time PCR analyses for line-specific quantitation of RT genetically modified maize and soybean using new reference molecules"; RL J AOAC Int 85:1119-1126 (2002). RX PUBMED; 12374412. XX RN [2] RP 1-118 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [3] RP 1-118 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QT-CON-00-001; XX FH Key Location/Qualifiers FH FT STS 1..118 FT /standard_name="PCR 118 bp amplicon" FT /note="Taxon-specific RT-PCR for soybean" FT /target="lectin (Le1) gene" FT primer_bind 1..19 FT /standard_name="Primer forward: Le1n02-5'" FT /note="GCCCTCTACTCCACCCCCA" FT /target="Le1" FT primer_bind 55..80 FT /standard_name="RT-PCR probe: Le1-Taq" FT /note="FAM-AGCTTCGCCGCTTCCTTCAACTTCAC-TAMRA" FT primer_bind complement(99..118) FT /standard_name="Primer reverse: Le1n02-3'" FT /note="GCCCATCTGCAAGCCTTTTT" FT /target="Le1" XX SQ Sequence 118 BP; 27 A; 43 C; 22 G; 26 T; 0 other; gccctctact ccacccccan nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnagcttc 60 gccgcttcct tcaacttcac nnnnnnnnnn nnnnnnnnaa aaaggcttgc agatgggc 118 //