ID QL-EVE-EC-002; SV 0; linear; genomic DNA; STS; BCT; 85 BP. XX AC ; XX DT 02-SEP-2008 DT 23-NOV-2017 XX DE Qualitative PCR method for detection of E. coli K-12 event 19E (EURL GMFF, 2015). XX KW event_specific. XX OS Escherichia coli K-12 (bacteria) - event 19E XX RN [1] RP 1-85 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific method for the detection of dried-killed bacterial biomass PL73 (LM) derived from Escherichia coli K-12 GM strain 19E using real-time PCR - JRC Validated Methods, Reference Methods and Measurements Reports"; RL Online Publication (2015). RX EURL_GMFF=CRL-VL-06-08-VR.pdf RX EURL_GMFF=CRL-VL-06-08-VP.pdf XX RN [2] RP 1-85 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2017). RX PCR=QL-EVE-EC-002.pdf XX FH Key Location/Qualifiers FH FT STS 1..85 FT /standard_name="PCR 85 bp amplicon" FT /note="Event-specific RT-PCR"; FT /target="5' integration border region (IBR) between the insert of E. coli K-12 event 19E and the bacterial host genome"; FT primer_bind 1..27 FT /standard_name="Primer forward: LMA for" FT /note="GGTTATCCAGTAATAGCCATCTTCATC" FT /target="5'-host genome" FT primer_bind 38..63 FT /standard_name="RT-PCR probe: LMA probe" FT /note="FAM-CCGTCGCCGCTGTATTGATTCACTTG-TAMRA" FT primer_bind complement(64..85) FT /standard_name="Primer reverse: LMA rev" FT /note="CCTCCCGGTTTTTTTCGTACTT" FT /target="insert" XX SQ Sequence 85 BP; 22 A; 22 C; 22 G; 19 T; 0 other; ggttatccag taatagccat cttcatcnnn nnnnnnnccg tcgccgctgt attgattcac 60 ttgaagtacg aaaaaaaccg ggagg 85 //