ID QL-CON-00-005; SV 0; linear; genomic DNA; STS; SYN; 209 BP. XX AC ACS-ZM003-2; XX DT 23-JUN-2009 DT 05-OCT-2016 XX DE Qualitative PCR method for detection of the junction between the pat gene and the CaMV35S terminator (ISO/FDIS 21569:2005). XX KW construct_specific. XX OS Zea mays (maize) - event T25 (ACS-ZM003-2) XX RN [1] RP 1-209 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Qualitative nucleic acid based RT methods"; RL ISO 21569:1-69 (2005). RX ISO=34614 XX RN [2] RP 1-209 RT "Detection of a genetic modification of maize (Zea mays L.) by RT amplification of the modified DNA sequence by means of the polymerase RT chain reaction (PCR) and hybridization of the PCR product with a DNA RT probe or restriction analysis of the PCR product, N. L 15.05-1"; RL Online Publication (2002). XX RN [3] RP 1-209 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-CON-00-005.pdf XX DR GMOMETHODS; QL-TAX-ZM-003; XX FH Key Location/Qualifiers FH FT STS 1..210 FT /standard_name="PCR 210 bp amplicon" FT /note="Construct-specific PCR" FT /target="Junction region between the phosphinothricin N-acetyltransferase (pat) gene from Streptomyces viridochromogenes and the Cauliflower Mosaic Virus 35S terminator (CaMV T-35S)" FT primer_bind 1..21 FT /standard_name="Primer forward: T25-F7" FT /note="ATGGTGGATGGCATGATGTTG" FT /target="pat" FT primer_bind complement(188..210) FT /standard_name="Primer reverse: T25-R3" FT /note="TGAGCGAAACCCTATAAGAACCC" FT /target="CaMV T-35S" XX SQ Sequence 210 BP; 49 A; 46 C; 52 G; 63 T; 0 other; atggtggatg gcatgatgtt gnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 180 nnnnnnnggg ttcttatagg gtttcgctca 210 //