European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.

Perform your search by inserting a key word or by selecting a GMO unique identifier.

Only one hit for query 'ac:MON-87708-9'
ID   QT-EVE-GM-012; SV 0; linear; genomic DNA; STS; SYN; 91 BP.
AC   MON-87708-9;
DT   02-FEB-2011
DT   29-NOV-2013
DE   Quantitative PCR method for detection of soybean event MON87708 (Savini et al., 2013).
KW   event_specific.
OS   Glycine max (soybean) - event MON87708 (MON-87708-9)
RN   [1]
RP   1-91
RA   Savini C., Mazzara M., Munaro B., Kreysa J.;
RT   "Event-specific Method for the Quantification of Soybean MON87708 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2013).
RX   DOI=10.2788/90943
RN   [2]
RP   1-91
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2013).
RX   PCR=QT-EVE-GM-012.pdf
FH   Key             Location/Qualifiers
FT   STS             1..91
FT                   /standard_name="PCR 91 bp amplicon"
FT                   /note="Event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of soybean event MON87708 and the soybean host genome";
FT   primer_bind     1..25
FT                   /standard_name="Primer forward: MON87708 primer 1"
FT                   /note="TCATACTCATTGCTGATCCATGTAG"
FT                   /target="insert"
FT   primer_bind     29..56
FT                   /standard_name="RT-PCR probe: MON87708 probe"
FT   primer_bind     complement(65..91)
FT                   /standard_name="Primer reverse: MON87708 primer 2"
FT                   /target="3'-host genome"
SQ   Sequence 91 BP; 19 A; 18 C; 14 G; 40 T; 0 other;
     tcatactcat tgctgatcca tgtagnnntc ccggacttta gctcaaaatg catgtannnn        60
     nnnncgttct gtcttttcgt taatttgttc t                                       91