ID QT-EVE-ZM-032; SV 0; linear; genomic DNA; STS; SYN; 92 BP. XX AC MON-00810-6; XX DT 29-MAY-2009 DT 21-DEC-2022 XX DE Quantitative droplet digital PCR method for detection of maize event MON810 (Gatto et al., 2022). XX KW event_specific. XX OS Zea mays (maize) - event MON810 (MON-00810-6) XX RN [1] RP 1-92 RA Gatto F., Savini C., Sacco MG., Vinciguerra D., Buttinger G., Corbisier P., Mazzara M., Emons H.; RT "Single and multi-laboratory validation of a droplet digital PCR method"; RL Food Control, 140:109117 (2022). RX DOI=10.1016/j.foodcont.2022.109117 XX RN [2] RP 1-92 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2022). RX PCR=QT-EVE-ZM-032.pdf XX DR GMOMETHODS; QT-TAX-ZM-007; XX FH Key Location/Qualifiers FH FT STS 1..92 FT /standard_name="PCR 92 bp amplicon" FT /note="Event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event MON810 and the maize host genome" FT primer_bind 1..24 FT /standard_name="Primer forward: Mail-F1" FT /note="TCGAAGGACGAAGGACTCTAACGT" FT /target="5'-host genome" FT primer_bind 27..49 FT /standard_name="RT-PCR probe: Mail-S2" FT /note="FAM-AACATCCTTTGCCATTGCCCAGC-TAMRA" FT primer_bind complement(69..92) FT /standard_name="Primer reverse: Mail-R1" FT /note="GCCACCTTCCTTTTCCACTATCTT" FT /target="insert" XX SQ Sequence 92 BP; 18 A; 6 C; 17 G; 7 T; 44 other; tcgaaggacg aaggactcta acgtnnaaca tcctttgcca ttgcccagcn nnnnnnnnnn 60 nnnnnnnnaa gatagtggaa aaggaaggtg gc 92 //