ID QT-TAX-OS-003; SV 0; linear; genomic DNA; STS; PLN; 81 BP. XX AC ; XX DT 23-JUN-2009 DT 26-AGO-2011 XX DE Quantitative PCR method for detection of rice sucrose-phosphate synthase gene DE (Jiang et al., 2009). XX KW taxon_specific, validated_independently. XX OS Oryza sativa (rice) XX RN [1] RP 1-81 RA Jiang L., Yang L., Zhang H., Guo J., Mazzara M., Van den Eede G., Zhang RA D.; RT "International collaborative study of the endogenous reference gene, RT sucrose phosphate synthase (SPS), used for qualitative and quantitative RT analysis of genetically modified rice"; RL J. Agric. Food Chem. 57:3525-3532 (2009). RX PUBMED; 19326953. RX DOI=10.1021/jf803166p XX RN [2] RP 1-81 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-TAX-OS-003.pdf XX FH Key Location/Qualifiers FH FT STS 1..81 FT /standard_name="PCR 81 bp amplicon" FT /note="Taxon-specific RT-PCR for rice" FT /target="sucrose-phosphate synthase (SPS) gene" FT primer_bind 1..18 FT /standard_name="Primer forward: SPS-1F" FT /note="TTGCGCCTGAACGGATAT" FT /target="SPS" FT primer_bind complement(42..60) FT /standard_name="RT-PCR probe: SPS-P" FT /note="HEX-TCCGAGCCGTCCGTGCGTC-TAMRA" FT primer_bind complement(62..81) FT /standard_name="Primer reverse: SPS-3R" FT /note="CGGTTGATCTTTTCGGGATG" FT /target="SPS" XX SQ Sequence 81 BP; 21 A; 23 C; 20 G; 17 T; 0 other; ttgcgcctga acggatatnn nnnnnnnnnn nnnnnnnnnn ngacgcacgg acggctcgga 60 ncatcccgaa aagatcaacc g 81 //