Only one hit for query 'id%3aqt-ele*%26ft%3a%27pat%27'
ID QT-EVE-GH-009; SV 0; linear; genomic DNA; STS; SYN; 78 BP. XX AC BCS-GH004-7; XX DT 16-NOV-2010 DT 24-JAN-2013 XX DE Quantitative PCR method for detection of cotton event T304-40 DE (Nardini et al., 2012). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event T304-40 (BCS-GH004-7) XX RN [1] RP 1-78 RA Nardini, E.,; RT "Event-specific Method for the Quantification of Cotton T304-40 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction from Cotton Seeds"; RL Online Publication (2012). RX EURL_GMFF=2012-10-29 EURL VL0511 VR.pdf RX EURL_GMFF=2012-10-29 EURL VL0511 VP.pdf XX RN [2] RP 1-78 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2012). RX PCR=QT-EVE-GH-009.pdf XX DR GMOMETHODS; QT-TAX-GH-019; XX FH Key Location/Qualifiers FH FT STS 1..78 FT /standard_name="PCR 78 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of cotton event T304-40 and the cotton host genome" FT primer_bind 1..22 FT /standard_name="Primer forward: SHA029" FT /note="AGCGCGCAAACTAGGATAAATT" FT /target="insert" FT primer_bind 24..46 FT /standard_name="RT-PCR probe: TM089" FT /note="FAM-TCGCGCGCGGTGTCATCTATCTC-TAMRA" FT primer_bind complement(52..78) FT /standard_name="Primer reverse: SHA030" FT /note="CCTAGATCTTGGGATAACTTGAAAAGA" FT /target="3'-host genome" XX SQ Sequence 78 BP; 19 A; 19 C; 15 G; 25 T; 0 other; agcgcgcaaa ctaggataaa ttntcgcgcg cggtgtcatc tatctcnnnn ntcttttcaa 60 gttatcccaa gatctagg 78 //