An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:DP-305423-1'
ID   QT-EVE-GM-008; SV 0; linear; genomic DNA; STS; SYN; 93 BP.
XX
AC   DP-305423-1;
XX
DT   18-JUL-2007
DT   15-MAR-2012
XX
DE   Quantitative PCR method for detection of soybean event 305423
DE   (Mazzara et al., 2009).
XX
KW   event_specific.
XX
OS   Glycine max (soybean) - event 305423 (DP-305423-1)
XX
RN   [1]
RP   1-93
RA   Mazzara M., Munaro B., Grazioli E., Savini C., Charles Delobel C., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Soybean Event DP-305423-1 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2009).
RX   DOI=10.2788/57423
XX
RN   [2]
RP   1-93
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GM-008.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..93
FT                   /standard_name="PCR 93 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of soybean event 305423 and the soybean host genome"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: DP305-f1"
FT                   /note="CGTGTTCTCTTTTTGGCTAGC"
FT                   /target="insert"
FT   primer_bind     complement(33..64)
FT                   /standard_name="RT-PCR probe: DP305-p"
FT                   /note="FAM-TGACACAAATGATTTTCATACAAAAGTCGAGA-TAMRA"
FT   primer_bind     complement(66..93)
FT                   /standard_name="Primer reverse: DP305-r5"
FT                   /note="GTGACCAATGAATACATAACACAAACTA"
FT                   /target="3'-host genome"
XX
SQ   Sequence 93 BP; 14 A; 13 C; 16 G; 38 T; 12 other;
     cgtgttctct ttttggctag cnnnnnnnnn nntctcgact tttgtatgaa aatcatttgt        60
     gtcantagtt tgtgttatgt attcattggt cac                                     93
//