Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-15985-7'
ID   QT-EVE-GH-008; SV 0; linear; genomic DNA; STS; SYN; 90 BP.
XX
AC   BCS-GH005-8;
XX
DT   15-NOV-2010
DT   20-NOV-2012
XX
DE   Quantitative PCR method for detection of cotton event GHB119 
DE   (Nardini et al., 2012).
XX
KW   event_specific.
XX
OS   Gossypium hirsutum (upland cotton) - event GHB119 (BCS-GH005-8)
XX
RN   [1]
RP   1-90
RA   Nardini E.,;
RT   "Event-Specific Method for the Quantification of Cotton GHB119 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction from Cotton Seeds";
RL   Online Publication (2012).
RX   EURL_GMFF=2012-10-11 EURL VL0411 VR.pdf
RX   EURL_GMFF=2012-10-11 EURL VL0411 VP.pdf
XX
RN   [2]
RP   1-90
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2012).
RX   PCR=QT-EVE-GH-008.pdf
XX
DR   GMOMETHODS; QT-TAX-GH-019;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..90
FT                   /standard_name="PCR 90 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of cotton event GHB119 and the cotton host genome"
FT   primer_bind     1..25
FT                   /standard_name="Primer forward: SHA021"
FT                   /note="CCAGTACTAAAATCCAGATCATGCA"
FT                   /target="insert"
FT   primer_bind     30..52
FT                   /standard_name="RT-PCR probe: TM082"
FT                   /note="FAM-CCTGCAGGTCGACGGCCGAGTAC-TAMRA"
FT   primer_bind     complement(69..90)
FT                   /standard_name="Primer reverse: NEL109"
FT                   /note="GAAATTGCGTGACTCAAATTCC"
FT                   /target="3'-host genome"
XX
SQ   Sequence 90 BP; 25 A; 20 C; 19 G; 26 T; 0 other;
     ccagtactaa aatccagatc atgcannnnc ctgcaggtcg acggccgagt acnnnnnnnn        60
     nnnnnnnngg aatttgagtc acgcaatttc                                         90
//