Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

ID   QT-EVE-GH-005; SV 0; linear; genomic DNA; STS; SYN; 82 BP.
AC   MON-15985-7;
DT   21-NOV-2005
DT   03-NOV-2010
DE   Quantitative PCR method for detection of cotton event MON15985
DE   (Savini et al., 2008).
KW   event_specific.
OS   Gossypium hirsutum (upland cotton) - event MON15985 (MON-15985-7)
RN   [1]
RP   1-82
RA   Savini C., Mazzara M., Munaro B., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Cotton Line MON 15985 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/4378
RN   [2]
RP   1-82
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GH-005.pdf
FH   Key             Location/Qualifiers
FT   STS             1..82
FT                   /standard_name="PCR 82 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of cotton event 15985 and the cotton host genome"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: MON15985 primer 1"
FT                   /note="GTTACTAGATCGGGGATATCC"
FT                   /target="insert"
FT   primer_bind     31..60
FT                   /standard_name="RT-PCR probe: MON15985 Probe"
FT   primer_bind     complement(62..82)
FT                   /standard_name="Primer reverse: MON15985 primer 2"
FT                   /note="AAGGTTGCTAAATGGATGGGA"
FT                   /target="3'-host genome"
SQ   Sequence 82 BP; 18 A; 20 C; 14 G; 20 T; 10 other;
     gttactagat cggggatatc cnnnnnnnnn ccgctctaga actagtggat ctgcactgaa        60
     ntcccatcca tttagcaacc tt                                                 82