An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'id:qt-ele*&ft:'pat''
ID   QT-ELE-00-002; SV 0; linear; genomic DNA; STS; SYN; 68 BP.
XX
AC   ;
XX
DT   23-JUN-2009
DT   20-SEP-2010
XX
DE   Quantitative PCR method for detection of phosphinothricin N-acetyltransferase gene
DE   (Weighard et al., 2004).
XX
KW   element_specific.
XX
RN   [1]
RP   1-68
RA   Weighardt F., Barbati C., Paoletti C., Querci M., Kay S., De Beuckeleer
RA   M., Van den Eede G.;
RT   "Real-time polymerase chain reaction-based approach for quantification of
RT   the pat gene in the T25 Zea mays event";
RL   J AOAC Int 87:1342-1355 (2004).
RX   PUBMED; 15675446.
XX
RN   [2]
RP   1-68
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-ELE-00-002.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..68
FT                   /standard_name="PCR 68 bp amplicon"
FT                   /note="element-specific RT-PCR"
FT                   /target="Phosphinothricin N-acetyltransferase (pat) gene from Streptomyces viridochromogenes"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: KVM-5"
FT                   /note="TTGAGGGTGTTGTGGCTGGTA"
FT                   /target="pat"
FT   primer_bind     complement(23..44)
FT                   /standard_name="RT-PCR probe: Pat1"
FT                   /note="FAM-CTTCCAGGGCCCAGCGTAAGCA-TAMRA"
FT   primer_bind     complement(48..68)
FT                   /standard_name="Primer reverse: KVM-6"
FT                   /note="TGTCCAATCGTAAGCGTTCCT"
FT                   /target="pat"
XX
SQ   Sequence 68 BP; 12 A; 12 C; 25 G; 19 T; 0 other;
     ttgagggtgt tgtggctggt antgcttacg ctgggccctg gaagnnnagg aacgcttacg        60
     attggaca                                                                 68
//