ID QT-TAX-GH-020; SV 0; linear; genomic DNA; STS; PLN; 73 BP. XX AC ; XX DT 04-AGO-2020 DT 04-AGO-2020 XX DE Quantitative PCR method for detection of cotton alcohol dehydrogenase C gene XX KW taxon_specific, validated_in_combination. XX OS Gossypium hirsutum (upland cotton) XX RN [1] RP 1-73 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Cotton GHB811 Using Real-time PCR - Validation Report"; RL Online Publication (2020). RX EURL_GMFF=EURL-VL-04-18-VR_GHB811.pdf RX EURL_GMFF=EURL-VL-04-18-VP_GHB811.pdf XX RN [2] RP 1-73 RT "See Cross-references below"; RL Online Publication (2020). XX DR GMOMETHODS; QT-EVE-GH-013; XX FH Key Location/Qualifiers FH FT STS 1..73 FT /standard_name="PCR 73 bp amplicon" FT /note="taxon-specific RT-PCR" FT /target="alcohol dehydrogenase C (AdhC) gene" FT primer_bind 1..23 FT /standard_name="Primer forward: KVM157" FT /note="CACATGACTTAGCCCATCTTTGC" FT /target="AdhC" FT primer_bind 25..50 FT /standard_name="RT-PCR probe: TM1304" FT /note="JOE-TGCAGGTTTTGGTGCCACTGTGAATG-BHQ1" FT primer_bind complement(53..73) FT /standard_name="Primer reverse: KVM158" FT /note="CCCACCCTTTTTTGGTTTAGC" FT /target="AdhC" XX SQ Sequence 73 BP; 18 A; 15 C; 19 G; 18 T; 3 other; cacatgactt agcccatctt tgcntgcagg ttttggtgcc actgtgaatg nngctaaacc 60 aaaaaagggt ggg 73 //