An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-88017-3'
ID   QT-EVE-ZM-016; SV 0; linear; genomic DNA; STS; SYN; 95 BP.
XX
AC   MON-88017-3;
XX
DT   11-JAN-2006
DT   05-NOV-2010
XX
DE   Quantitative PCR method for detection of maize event MON88017
DE   (Charles Delobel et al., 2008).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MON88017 (MON-88017-3)
XX
RN   [1]
RP   1-95
RA   Charles Delobel C., Foti N., Grazioli E., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line MON 88017 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/43272
XX
RN   [2]
RP   1-95
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-016.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..95
FT                   /standard_name="PCR 95 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of maize event MON 88017 and the maize host genome"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: MON88017 AF"
FT                   /note="GAGCAGGACCTGCAGAAGCT"
FT                   /target="insert"
FT   primer_bind     47..75
FT                   /standard_name="RT-PCR probe: MON88017 AP"
FT                   /note="FAM-TCCCGCCTTCAGTTTAAACAGAGTCGGGT-TAMRA"
FT   primer_bind     complement(77..95)
FT                   /standard_name="Primer reverse: MON88017 AR"
FT                   /note="TCCGGAGTTGACCATCCA"
FT                   /target="3'-host genome"
FT   misc_difference 94
FT                   /note="There is a mismatch between the sequence 'T' of
FT                   the rev-primer MON88017 Primer 2 and the reported genomic
FT                   sequence 'C'of MON88017. According to Monsanto this does
FT                   not have a bad influence on the PCR and the method has
FT                   been validated."
XX
SQ   Sequence 95 BP; 16 A; 18 C; 20 G; 14 T; 27 other;
     gagcaggacc tgcagaagct nnnnnnnnnn nnnnnnnnnn nnnnnntccc gccttcagtt        60
     taaacagagt cgggtntgga tggtcaactc cggca                                   95
//