ID QT-TAX-GH-016; SV 0; linear; genomic DNA; STS; PLN; 123 BP. XX AC ; XX DT 12-JUN-2008 DT 11-DEC-2019 XX DE Quantitative PCR method for detection of putative cotton SAH7 protein DE gene (123 bp) DE (Mazzara et al., 2006). XX KW taxon_specific, validated_in_combination. XX OS Gossypium hirsutum (upland cotton) XX RN [1] RP 1-123 RA Mazzara M., Larcher S., Savini C., Charles Delobel C., Van Den Eede G.; RT "Event-Specific Methods for the Quantitation of the Hybrid Cotton Line 281-24-236/3006-210-23 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Cotton Seeds"; RL Online Publication (2006). RX DOI=10.2788/32649 XX RN [2] RP 1-123 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Cotton DAS-81910-7 Using Real-time PCR - Validation Report"; RL Online Publication (2019). RX EURL_GMFF=EURL-VL-06_16_VR.pdf RX EURL_GMFF=EURL-VL-06_16_VP.pdf XX RN [3] RP 1-123 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QT-EVE-GH-001a; DR GMOMETHODS; QT-EVE-GH-001b; DR GMOMETHODS; QT-EVE-GH-011; XX FH Key Location/Qualifiers FH FT STS 1..123 FT /standard_name="PCR 123 bp amplicon" FT /note="taxon-specific RT-PCR" FT /target="IVS of the putative Sinapis Arabidopsis Homolog 7 (SAH7) protein gene of Gossypium hirsutum D-subgenome" FT /note="The cotton endogenous gene SAH7 (Sinapis Arabidopsis Homolog 7) is present on both cotton subgenomes A and D. Primers and probe for this cotton-specific reference system match perfectly to both subgenome gene copies but amplify a 115-bp fragment from the A-subgenome and a 123-bp fragment from the D-subgenome" FT primer_bind 1..28 FT /standard_name="Primer forward: Sah7-uni-f1" FT /note="AGTTTGTAGGTTTTGATGTTACATTGAG" FT /target="SAH7" FT primer_bind 52..84 FT /standard_name="RT-PCR probe: Sah7-uni-s1" FT /note="FAM-AAACATAAAATAATGGGAACAACCATGACATGT-TAMRA" FT primer_bind complement(103..123) FT /standard_name="Primer reverse: Sah7-uni-r1" FT /note="GCATCTTTGAACCGCCTACTG" FT /target="SAH7" XX SQ Sequence 123 BP; 29 A; 10 C; 20 G; 23 T; 41 other; agtttgtagg ttttgatgtt acattgagnn nnnnnnnnnn nnnnnnnnnn naaacataaa 60 ataatgggaa caaccatgac atgtnnnnnn nnnnnnnnnn nncagtaggc ggttcaaaga 120 tgc 123 //