An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'id:QL-ELE*&ft:pCambia'
ID   QL-ELE-00-023; SV 1; circular; other DNA; STD; SYN; 137 BP.
XX
AC   ;
XX
DT   24-APR-2000
DT   21-DEC-2016
XX
DE   Qualitative PCR method for detection of T35S pCAMBIA sequences (Rischitor et al., 2016).
XX
KW   element_specific.
XX
RN   [1]
RP   1-137
RA   Rischitor P., Lievens A., Mazzara M.;
RT   " Element-specific method for t35S-pCAMBIA detection using real-time PCR - Validation Report Qualitative Screening Method";
RL   Online Publication (2016).
XX
RN   [2]
RP   1-137
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2016).
RX   PCR=QL-ELE-00-023.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..137
FT                   /standard_name="PCR 137 bp amplicon"
FT                   /note="element-specific PCR"
FT                   /target="Cauliflower Mosaic Virus 35S terminator (CaMV T-35S) in pCAMBIA vector"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: t35S pCAMBIA c-F"
FT                   /note="CGGGGGATCTGGATTTTAGTA"
FT                   /target="T35S pCAMBIA"
FT   primer_bind     complement(115..137)
FT                   /standard_name="Primer reverse: t35S pCAMBIA a-R"
FT                   /note="AGGGTTCCTATAGGGTTTCGCTC"
FT                   /target="T35S pCAMBIA"
XX
SQ   Sequence 137 BP; 45 A; 19 C; 27 G; 46 T; 0 other;
     cgggggatct ggattttagt actggatttt ggttttagga attagaaatt ttattgatag        60
     aagtatttta caaatacaaa tacatactaa gggtttctta tatgctcaac acatgagcga       120
     aaccctatag gaaccct                                                      137
//