Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:DAS-44406-6'
ID   QT-EVE-GM-015; SV 0; linear; genomic DNA; STS; SYN; 99 BP.
XX
AC   DAS-44406-6;
XX
DT   18-JUN-2012
DT   07-MAY-2015
XX
DE   Quantitative PCR method for detection of soybean event DAS-44406-6 (EURL GMFF, 2015).
XX
KW   event_specific.
XX
OS   Glycine max (soybean)- event DAS-44406-6(DAS-44406-6)
XX
RN   [1]
RP   1-99
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Soybean DAS-44406-6 by Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2015).
RX   EURL_GMFF=EURL-VL-0112%20VR_Final.pdf
RX   EURL_GMFF=EURL-VL-01-12_VP_Final.pdf
XX
RN   [2]
RP   1-99
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2015).
RX   PCR=QT-EVE-GM-015.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..99
FT                   /standard_name="PCR 99 bp amplicon"
FT                   /note="Event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of soybean event DAS-44406-6 and the soybean host genome"
FT   primer_bind     1..28
FT                   /standard_name="Primer forward: DAS-44406-5F"
FT                   /note="TTATTGTTCTTGTTGTTTCCTCTTTAGG"
FT                   /target="5'-host genome"                 
FT   primer_bind     complement(41..69)
FT                   /standard_name="RT-PCR probe: DAS-44406-6-5p1"
FT                   /note="FAM-ATTCGGACCTCCATGATGACCTTACCGTT-TAMRA"
FT   primer_bind     complement(76..99)
FT                   /standard_name="Primer reverse: DAS-44406-5R"
FT                   /note="CCTCAATTGCGAGCTTTCTAATTT"
FT                   /target="insert"
XX
SQ   Sequence 99 BP; 27 A; 14 C; 23 G; 35 T; 0 other;
     ttattgttct tgttgtttcc tctttaggnn nnnnnnnnnn aacggtaagg tcatcatgga        60
     ggtccgaatn nnnnnaaatt agaaagctcg caattgagg                               99
//