Only one hit for query 'ac%3aDAS-44406-6'
ID QT-TAX-BN-012; SV 0; linear; genomic DNA; STS; PLN; 101 BP. XX AC ; XX DT 26-JUN-2008 DT 05-DEC-2011 XX DE Quantitative PCR method for detection of oilseed rape cruciferin A gene XX KW taxon_specific, validated_in_combination. XX OS Brassica napus (oilseed rape) XX RN [1] RP 1-101 RA Mazzara M., Grazioli E., Savini C., Van Den Eede G.; RT Event-Specific Method for the Quantification of Oilseed Rape Line RT73 Using Real-Time PCR - Validation Report and Protocol - Seeds Sampling and DNA Extraction of Oilseed Rape; RL Online Publication (2007). RX DOI=10.2788/33974 XX RN [2] RP 1-101 RA Mazzara M., Bogni A., Savini C., Van Den Eede G.; RT "Event-specific Method for the Quantification of Oilseed Rape Line Ms8 Using Real-time PCR - Validation Report and Protocol- Seeds Sampling and DNA Extraction of Oilseed Rape"; RL Online Publication (2007). RX DOI=10.2788/33880 XX RN [3] RP 1-101 RA Savini C., Bogni A., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Oilseed Rape Line Rf3 Using Real-time PCR - Validation Report and Protocol - Seeds Sampling and DNA Extraction"; RL Online Publication (2007). RX DOI=10.2788/28179 XX RN [4] RP 1-101 RA Charles Delobel C., Bogni A., Mazzara M., Savini C., Van Den Eede G.; RT "Event-specific Method for the Quantification of Oilseed Rape Line T45 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Oilseed Rape"; RL Online Publication (2006). RX DOI=10.2788/30936 XX RN [5] RP 1-101 RA Savini C., ; RT "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape MS1 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2011). RX EURL_GMFF=CRLVL1104 VR.pdf RX EURL_GMFF=CRLVL1104 VP.pdf XX RN [6] RP 1-101 RA Mazzara M.,; RT "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape RF1 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2011). RX EURL_GMFF=CRLVL0904 VR.pdf RX EURL_GMFF=CRLVL0904 VP.pdf XX RN [7] RP 1-101 RA Mazzara M.,; RT "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape RF2 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2011). RX EURL_GMFF=Rf2 Validation Report.pdf RX EURL_GMFF=Rf2 Validated Method Protocol CRL-VL-1004.pdf XX RN [8] RP 1-101 RA Mazzara M.,; RT "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape Topas 19/2 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2011). RX EURL_GMFF=CRLVL1204 VR.pdf RX EURL_GMFF=CRLVL1204 VP.pdf XX RN [9] RP 1-101 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QT-EVE-BN-004; DR GMOMETHODS; QT-EVE-BN-002; DR GMOMETHODS; QT-EVE-BN-003; DR GMOMETHODS; QT-EVE-BN-001; DR GMOMETHODS; QT-EVE-BN-005; DR GMOMETHODS; QT-EVE-BN-006; DR GMOMETHODS; QT-EVE-BN-007; DR GMOMETHODS; QT-EVE-BN-008; XX FH Key Location/Qualifiers FH FT STS complement(1..101) FT /standard_name="PCR 101 bp amplicon" FT /note="taxon-specific RT-PCR for oilseed rape" FT /target="cruciferin A (CruA) gene" FT primer_bind 1..18 FT /standard_name="Primer forward: MDB510" FT /note="GGCCAGGGTTTCCGTGAT" FT /target="CruA" FT primer_bind complement(20..48) FT /standard_name="RT-PCR probe: TM003" FT /note="VIC-AGTCCTTATGTGCTCCACTTTCTGGTGCA-TAMRA" FT primer_bind complement(81..101) FT /standard_name="Primer reverse: MDB511" FT /note="CCGTCGTTGTAGAACCATTGG" FT /target="CruA" XX SQ Sequence 101 BP; 19 A; 16 C; 20 G; 13 T; 33 other; ggccagggtt tccgtgatnt gcaccagaaa gtggagcaca taaggactnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn ccaatggttc tacaacgacg g 101 //