Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-15985-7'
ID   QL-EVE-OS-001; SV 0; linear; genomic DNA; STS; SYN; 66 BP.
XX
AC   BCS-OS003-7;
XX
DT   06-DEC-2011
DT   26-FEB-2008
XX
DE   Qualitative PCR method for detection of rice event LLRICE601 (verified by the EU-RL GMFF in the context of Commission Decision 2006/578/EC)
XX
KW   event_specific, EU-RL_GMFF_in-house_verified.
XX
OS   Oryza sativa (rice) - event LLRICE601 (BCS-OS003-7)
XX
RN   [1]
RP   1-66
RA   Mazzara M., Cordeil S., Van den Eede G.;
RT   "Report on the Verification of an Event-specific Detection Method for
RT   Identification of Rice GM-Event LLRICE601 Using a Real-time PCR Assay";
RL   Online Publication (2006).
RX   EURL_GMFF=Verification Report LLRice601 event.pdf
XX
RN   [2]
RP   1-66
RA   Mazzara M., Cordeil S., Van den Eede G.;
RT   "Addendum to the Report on the Verification of an Event-specific
RT   Detection Method for Identification of Rice GM-Event LLRICE601 Using a
RT   Real-time PCR Assay";
RL   Online Publication (2006).
RX   EURL_GMFF=Verification Report LLRice601 event addendum on Table 4.pdf
XX
RN   [3]
RP   1-66
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2011).
RX   PCR=QL-EVE-OS-001.pdf
XX
DR   GMOMETHODS; QL-TAX-OS-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..66
FT                   /standard_name="PCR 66 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of rice event LLRICE601 and the rice host genome";
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: SHA040"
FT                   /note="TCTAGGATCCGAAGCAGATCGT"
FT                   /target="insert";
FT   primer_bind     24..49
FT                   /standard_name="RT-PCR probe:  TM098"
FT                   /note="FAM-CCACCTCCCAACAATAAAAGCGCCTG-TAMRA"
FT   primer_bind     complement(51..66)
FT                   /standard_name="Primer reverse: SHA041"
FT                   /note="GGAGGGCGCGGAGTGT"
FT                   /target="3'-host genome"
XX
SQ   Sequence 66 BP; 17 A; 27 C; 11 G; 11 T; 0 other;
     tctaggatcc gaagcagatc gtnccacctc ccaacaataa aagcgcctgn acactccgcg        60
     ccctcc                                                                   66
//