ID QT-TAX-GH-015; SV 0; linear; mRNA; STS; PLN; 76 BP. XX AC ; XX DT 25-JUN-2008 DT 12-JUL-2016 XX DE Quantitative PCR method for detection of cotton fiber-specific acyl carrier protein gene XX KW taxon_specific, validated_in_combination. XX OS Gossypium hirsutum (upland cotton) XX RN [1] RP 1-76 RA Mazzara M., Bogni A., Van Den Eede G.; RT "Event-specific Method for the Quantification of Cotton Line MON1445 Using Real-time PCR Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/4455 XX RN [2] RP 1-76 RA Savini C., Mazzara M., Munaro B., Van Den Eede G.; RT "Event-specific Method for the Quantification of Cotton Line MON 15985 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/4378 XX RN [3] RP 1-76 RA Mazzara M., Bogni A., Foti N., Van Den Eede G.; RT "Event-specific Method for the Quantification of Cotton Line MON 531 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/43936 XX RN [4] RP 1-76 RA Charles Delobel C., Luque Perez E., Pinski G., Bogni A., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Cotton MON 88913 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2009). RX DOI=10.2788/58818 XX RN [5] RP 1-76 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Cotton MON88701 Using Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2016). RX EURL_GMFF=EURL-VL-01-13-VR.pdf RX EURL_GMFF=MON-88701-Validated-Method.pdf XX RN [6] RP 1-76 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QT-EVE-GH-003; DR GMOMETHODS; QT-EVE-GH-005; DR GMOMETHODS; QT-EVE-GH-004; DR GMOMETHODS; QT-EVE-GH-007; DR GMOMETHODS; QT-EVE-GH-010; XX FH Key Location/Qualifiers FH FT STS 1..76 FT /standard_name="PCR 76 bp amplicon" FT /note="taxon-specific RT-PCR for cotton" FT /target="fiber-specific acyl carrier protein (ACP1)" FT primer_bind 1..23 FT /standard_name="Primer forward: acp1 primer 1" FT /note="ATTGTGATGGGACTTGAGGAAGA~One mismatch found: 331st FT nucleotide, based on the sequence coming from EMBL record FT with accession number U48777, is T. 7th nucleotide, based FT on CRL dossier concerning GMO event MON1445, MON15985 and FT MON531, is A." FT /target="ACP1" FT primer_bind complement(25..51) FT /standard_name="RT-PCR probe: acp1 probe" FT /note="FAM-ATTGTCCTCTTCCACCGTGATTCCGAA-TAMRA. ~One mismatch found: FT 375th nucleotide, based on the sequence coming from EMBL FT record with accession number U48777, is C. 1st FT nucleotide, based on CRL dossier concerning GMO event FT MON1445, MON15985 and MON531, is A." FT primer_bind complement(53..76) FT /standard_name="Primer reverse: acp1 primer 2" FT /note="CTTGAACAGTTGTGATGGATTGTG" FT /target="ACP1" XX SQ Sequence 76 BP; 24 A; 14 C; 20 G; 16 T; 2 other; attgtgttgg gacttgagga aganttcgga atcacggtgg aagaggacaa cncacaatcc 60 atcacaactg ttcaag 76 //