Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-TAX-GH-022; SV 0; linear; genomic DNA; STS; PLN; 115 BP.
XX
AC   ;
XX
DT   12-JUN-2008
DT   20-MAR-2020
XX
DE   Quantitative PCR method for detection of putative cotton SAH7 protein
DE   gene (115 bp).
DE   (EURL GMFF, 2020).
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Gossypium hirsutum (upland cotton)
XX
RN   [1]
RP   1-115
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Cotton COT102 Using Real-time PCR - Validation Report";
RL   Online Publication (2020).
RX   EURL_GMFF=EURL-VL-05-16-VR.pdf
RX   EURL_GMFF=EURL-VL-05-16-VM.pdf
XX
RN   [2]
RP   1-115
RT   "See Cross-references below";
RL   Online Publication (2020).
XX
DR   GMOMETHODS; QT-EVE-GH-012;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..115
FT                   /standard_name="PCR 115 bp amplicon"
FT                   /note="taxon-specific RT-PCR"
FT                   /target="IVS of the putative Sinapis Arabidopsis Homolog 7 (SAH7) protein gene of Gossypium hirsutum A-subgenome"
FT                   /note="The cotton endogenous gene SAH7 (Sinapis Arabidopsis Homolog 7) is present on both cotton subgenomes A and D. Primers and probe for this cotton-specific reference system match perfectly to both subgenome gene copies but amplify a 115-bp fragment from the A-subgenome and a 123-bp fragment from the D-subgenome"
FT   primer_bind     1..28
FT                   /standard_name="Primer forward: Sah7-uni-f1"
FT                   /note="AGTTTGTAGGTTTTGATGTTACATTGAG"
FT                   /target="SAH7"
FT   primer_bind     52..84
FT                   /standard_name="RT-PCR probe: Sah7-uni-s1"
FT                   /note="VIC-AAACATAAAATAATGGGAACAACCATGACATGT-TAMRA"
FT   primer_bind     complement(95..115)
FT                   /standard_name="Primer reverse: Sah7-uni-r1"
FT                   /note="GCATCTTTGAACCGCCTACTG"
FT                   /target="SAH7"
XX
SQ   Sequence 115 BP; 29 A; 10 C; 20 G; 23 T; 33 other;
     agtttgtagg ttttgatgtt acattgagnn nnnnnnnnnn nnnnnnnnnn naaacataaa        60
     ataatgggaa caaccatgac atgtnnnnnn nnnncagtag gcggttcaaa gatgc            115
//