Only one hit for query 'ac%3aBCS-GH005-8'
ID QT-TAX-GH-022; SV 0; linear; genomic DNA; STS; PLN; 115 BP. XX AC ; XX DT 12-JUN-2008 DT 20-MAR-2020 XX DE Quantitative PCR method for detection of putative cotton SAH7 protein DE gene (115 bp). DE (EURL GMFF, 2020). XX KW taxon_specific, validated_in_combination. XX OS Gossypium hirsutum (upland cotton) XX RN [1] RP 1-115 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Cotton COT102 Using Real-time PCR - Validation Report"; RL Online Publication (2020). RX EURL_GMFF=EURL-VL-05-16-VR.pdf RX EURL_GMFF=EURL-VL-05-16-VM.pdf XX RN [2] RP 1-115 RT "See Cross-references below"; RL Online Publication (2020). XX DR GMOMETHODS; QT-EVE-GH-012; XX FH Key Location/Qualifiers FH FT STS 1..115 FT /standard_name="PCR 115 bp amplicon" FT /note="taxon-specific RT-PCR" FT /target="IVS of the putative Sinapis Arabidopsis Homolog 7 (SAH7) protein gene of Gossypium hirsutum A-subgenome" FT primer_bind 1..28 FT /standard_name="Primer forward: Sah7-uni-f1" FT /note="AGTTTGTAGGTTTTGATGTTACATTGAG" FT /target="SAH7" FT primer_bind 52..84 FT /standard_name="RT-PCR probe: Sah7-uni-s1" FT /note="VIC-AAACATAAAATAATGGGAACAACCATGACATGT-TAMRA" FT primer_bind complement(95..115) FT /standard_name="Primer reverse: Sah7-uni-r1" FT /note="GCATCTTTGAACCGCCTACTG" FT /target="SAH7" XX SQ Sequence 115 BP; 29 A; 10 C; 20 G; 23 T; 33 other; agtttgtagg ttttgatgtt acattgagnn nnnnnnnnnn nnnnnnnnnn naaacataaa 60 ataatgggaa caaccatgac atgtnnnnnn nnnncagtag gcggttcaaa gatgc 115 //