ID QT-TAX-BN-002; SV 0; linear; genomic DNA; STS; PLN; 78 BP. XX AC ; XX DT 22-NOV-2012 DT 03-DEC-2013 XX DE Quantitative PCR method for detection of oilseed rape cruciferin DE storage protein (Savini et al., 2013). XX KW taxon_specific, validated_in_combination. XX OS Brassica napus (oilseed rape) XX RN [1] RP 1-78 RA Savini C., et al.; RT "Event-specific Method for the Quantification of Oilseed Rape MON88302 Using Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2013). RX EURL_GMFF=EURL-VL-09-11-VR-MON88302.pdf RX EURL_GMFF=EURL-VL-09-11-VM-MON88302.pdf XX RN [2] RP 1-78 RT "See Cross-references below"; RL Online Publication (2013). XX DR GMOMETHODS; QT-EVE-BN-010; XX FH Key Location/Qualifiers FH FT STS 1..78 FT /standard_name="PCR 78 bp amplicon" FT /note="taxon-specific RT-PCR" FT /target="cruciferin storage protein (BnC1) gene" FT primer_bind 1..24 FT /standard_name="Primer forward: ccf R" FT /note="GCTTCCGTGATATGCACCAGAAAG" FT /target="BnC1" FT primer_bind complement(27..54) FT /standard_name="RT-PCR probe: ccf P" FT /note="VIC-CGATGGTGTCCCCAGTCCTTATGTGCTC-TAMRA" FT primer_bind complement(57..78) FT /standard_name="Primer reverse: ccf F" FT /note="ATTGGGCTACACCGGGATGTGT" FT /target="BnC1" XX SQ Sequence 78 BP; 22 A; 22 C; 20 G; 14 T; 0 other; gcttccgtga tatgcaccag aaagnngagc acataaggac tggggacacc atcgnnacac 60 atcccggtgt agcccaat 78 //