An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:ACS-GM006-4'
ID   QT-EVE-GM-007; SV 0; linear; genomic DNA; STS; SYN; 75 BP.
XX
AC   ACS-GM006-4;
XX
DT   07-APR-2008
DT   15-MAR-2012
XX
DE   Quantitative PCR method for detection of soybean event A5547-127
DE   (Charles Delobel et al., 2009).
XX
KW   event_specific.
XX
OS   Glycine max (soybean) - event A5547-127 (ACS-GM006-4)
XX
RN   [1]
RP   1-75
RA   Charles Delobel C., Bogni A., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Soybean Line A5547-127 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2009).
RX   DOI=10.2788/60083
XX
RN   [2]
RP   1-75
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GM-007.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-020;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..75
FT                   /standard_name="PCR 75 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of soybean event A5547-127 and the soybean host genome"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: SHA003"
FT                   /note="GCTATTTGGTGGCATTTTTCCA"
FT                   /target="5'-host genome"
FT   primer_bind     28..53
FT                   /standard_name="RT-PCR probe: TM058"
FT                   /note="FAM-CCGCAATGTCATACCGTCATCGTTGT-TAMRA"
FT   primer_bind     complement(55..75)
FT                   /standard_name="Primer reverse: SHA004"
FT                   /note="CACTGCGGCCAACTTACTTCT"
FT                   /target="insert"
XX
SQ   Sequence 75 BP; 14 A; 15 C; 18 G; 22 T; 6 other;
     gctatttggt ggcatttttc cannnnnccg caatgtcata ccgtcatcgt tgtnagaagt        60
     aagttggccg cagtg                                                         75
//