ID QT-EVE-ZM-038; SV 0; linear; genomic DNA; STD; PLN; 108 BP. XX AC DP-910521-2; XX DT 07-JUN-2024 DT 07-JUN-2024 XX DE Quantitative PCR method for detection of maize event DP910521 (EURL GMFF, 2024). XX KW event_specific. XX OS Zea mays (maize) - event DP910521 (DP-910521-2) XX RN [1] RP 1-108 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize DP910521 Using Real-time PCR - Validation Report"; RL Online Publication (2024). RX EURL_GMFF=EURL-VL-04-21-VR.pdf RX EURL_GMFF=EURL-VL-04-21-VM.pdf XX RN [2] RP 1-108 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2024). RX PCR=QT-EVE-ZM-038.pdf XX DR GMOMETHODS; QT-TAX-ZM-008; XX FH Key Location/Qualifiers FH FT STS 1..108 FT /standard_name="PCR 108 bp amplicon" FT /note="Event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event DP910521 and the maize host genome" FT primer_bind 1..25 FT /standard_name="Primer forward: PHN201324" FT /note="CTCTTGACACTTTGTATTGGTGCTC" FT /target="5'-host genome" FT primer_bind 26..42 FT /standard_name="RT-PCR probe: PHN201325" FT /note="FAM-TTGGGCTCAAGAGGGTA-MGBNFQ" FT primer_bind complement(87..108) FT /standard_name="Primer reverse: PHN165631" FT /note="CATAGTAACCGTGAGCGCTTCA" FT /target="insert" XX SQ Sequence 108 BP; 24 A; 25 C; 27 G; 32 T; 0 other; ctcttgacac tttgtattgg tgctcttggg ctcaagaggg tannnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnntgaa gcgctcacgg ttactatg 108 //