ID QT-EVE-ZM-037; SV 0; linear; genomic DNA; STD; SYN; 103 BP. XX AC MON-94804-4; XX DT 06-JUN-2024 DT 06-JUN-2024 XX DE Quantitative PCR method for detection of maize event MON 94804 (EURL GMFF, 2024). XX KW event_specific. XX OS Zea mays (maize) - event MON 94804 (MON-94804-4) XX RN [1] RP 1-103 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize MON 94804 Using RT Real-time PCR - Validation Report"; RL Online Publication (2024). RX EURL_GMFF=EURL-VL-06-22-VR.pdf RX EURL_GMFF=EURL-VL-06-22-VM.pdf XX RN [2] RP 1-103 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2024). RX PCR=QT-EVE-ZM-037.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..103 FT /standard_name="PCR 103 bp amplicon" FT /note="Event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event MON 94804 and the maize host genome" FT primer_bind 1..21 FT /standard_name="Primer forward: MON 94804 primer 1" FT /note="CTCTTCTAATCCGGGCCATCG" FT /target="5'-host genome" FT primer_bind 25..53 FT /standard_name="RT-PCR probe: MON 94804 probe" FT /note="FAM-CTGGATCCGAAGGACGTGTCTACATTCAC-TAMRA" FT primer_bind complement(83..103) FT /standard_name="Primer reverse: MON 94804 primer 2" FT /note="AGTTAGTCGCGCCAAATCGTG" FT /target="insert" XX SQ Sequence 103 BP; 25 A; 27 C; 26 G; 25 T; 0 other; ctcttctaat ccgggccatc gnnnctggat ccgaaggacg tgtctacatt cacnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nncacgattt ggcgcgacta act 103 //