An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:DAS-21023-5'
ID   QT-EVE-GH-001b; SV 0; linear; genomic DNA; STS; SYN; 90 BP.
XX
AC   DAS-21023-5;
XX
DT   01-JAN-1900
DT   17-NOV-2010
XX
DE   Quantitative PCR method for detection of cotton event 3006-210-23
DE   (Mazzara et al., 2006).
XX
KW   event_specific.
XX
OS   Gossypium hirsutum (upland cotton) - event 3006-210-23 (DAS-21023-5)
XX
RN   [1]
RP   1-90
RA   Mazzara M., Larcher S., Savini C., Charles Delobel C., Van Den Eede G.;
RT   "Event-Specific Methods for the Quantitation of the Hybrid Cotton Line 281-24-236/3006-210-23 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Cotton Seeds";
RL   Online Publication (2006).
RX   DOI=10.2788/32649
XX
RN   [2]
RP   1-90
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GH-001b.pdf
XX
DR   GMOMETHODS; QT-TAX-GH-016;
DR   GMOMETHODS; QT-TAX-GH-021;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..90
FT                   /standard_name="PCR 90 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of cotton event 3006-210-23 and the cotton host genome"
FT   primer_bind     1..27
FT                   /standard_name="Primer forward: 3006-f3"
FT                   /note="AAATATTAACAATGCATTGAGTATGATG"
FT                   /target="5'-host genome"
FT   primer_bind     complement(31..60)
FT                   /standard_name="RT-PCR probe: 3006-s2"
FT                   /note="FAM- TACTCATTGCTGATCCATGTAGATTTCCCG-TAMRA"
FT   primer_bind     complement(65..90)
FT                   /standard_name="Primer reverse: 3006-r2"
FT                   /note="ACTCTTTCTTTTTCTCCATATTGACC"
FT                   /target="insert"
XX
SQ   Sequence 90 BP; 36 A; 8 C; 20 G; 19 T; 7 other;
     aaatattaac aatgcattga gtatgatgnn cgggaaatct acatggatca gcaatgagta        60
     nnnnggtcaa tatggagaaa aagaaagagt                                         90
//