ID QT-EVE-ZM-033; SV 0; linear; genomic DNA; STD; PLN; 87 BP. XX AC MON-95379-3; XX DT 20-DEC-2022 DT 20-DEC-2022 XX DE Quantitative PCR method for detection of maize event MON 95379 (EURL GMFF, 2022). XX KW event_specific. XX OS Zea mays (maize) - event MON 95379 (MON-95379-3) XX RN [1] RP 1-87 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize MON 95379 Using Real-time PCR - Validation Report"; RL Online Publication (2022). RX EURL_GMFF=EURL-VL-06-20-VR.pdf RX EURL_GMFF=EURL-VL-06-20-VM.pdf XX RN [2] RP 1-87 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2022). RX PCR=QT-EVE-ZM-033.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..87 FT /standard_name="PCR 87 bp amplicon" FT /note="Event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of maize event MON 95379 and the maize host genome" FT primer_bind 1..22 FT /standard_name="Primer forward: MON 95379 primer 1" FT /note="CCAAGAAGAACGATTGGCAAAC" FT /target="insert" FT primer_bind 30..62 FT /standard_name="RT-PCR probe: MON 95379 probe" FT /note="FAM-ATGGGTATTATGGGTAGGCACATGGGAATATAG-TAMRA" FT primer_bind complement(70..87) FT /standard_name="Primer reverse: MON 95379 primer 2" FT /note="GGCACAGGCACGCCTCTG" FT /target="3'-host genome" XX SQ Sequence 87 BP; 25 A; 14 C; 30 G; 18 T; 0 other; ccaagaagaa cgattggcaa acnnnnnnna tgggtattat gggtaggcac atgggaatat 60 agnnnnnnnc agaggcgtgc ctgtgcc 87 //