An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-89034-3'
ID   QT-EVE-ZM-018; SV 0; linear; genomic DNA; STS; PLN; 77 BP.
XX
AC   MON-89034-3;
XX
DT   01-APR-2009
DT   17-NOV-2010
XX
DE   Quantitative PCR method for detection of maize event MON89034
DE   (Savini et al., 2008).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MON89034 (MON-89034-3)
XX
RN   [1]
RP   1-77
RA   Savini C., Bogni A., Grazioli E., Munaro B., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line MON89034 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/68713
XX
RN   [2]
RP   1-77
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-018.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..77
FT                   /standard_name="PCR 77 bp_amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of maize event MON89034 and the maize host genome"
FT   primer_bind     1..27
FT                   /standard_name="Primer forward: MON89034 primer 1"
FT                   /note="TTCTCCATATTGACCATCATACTCATT"
FT                   /target="insert"
FT   primer_bind     30..47
FT                   /standard_name="RT-PCR probe: MON89034 probe"
FT                   /note="FAM-ATCCCCGGAAATTATGTT-MGBNFQ"
FT   primer_bind     complement(50..77)
FT                   /standard_name="Primer reverse: MON89034 primer 2"
FT                   /note="CGGTATCTATAATACCGTGGTTTTTAAA"
FT                   /target="3'-host genome"
XX
SQ   Sequence 77 BP; 23 A; 17 C; 8 G; 25 T; 4 other;
     ttctccatat tgaccatcat actcattnna tccccggaaa ttatgttnnt ttaaaaacca        60
     cggtattata gataccg                                                       77
//