ID QL-ELE-00-031; SV 0; linear; genomic DNA; STD; SYN; 184 BP. XX AC ; XX DT 01-APR-2009 DT 07-DEC-2018 XX DE Qualitative LAMP method for detection of Figwort Mosaic Virus 35S promoter (Li et al., 2019). XX KW element_specific. XX RN [1] RP 1-184 RA Li R., Shi J., Liu B., Wang C., Zhang D., Zhao X.; RT "Inter-laboratory validation of visual loop-mediated isothermal RT amplification assays for GM contents screening"; RL Food Chemistry 274:659-663 (2019). RX DOI=10.1016/j.foodchem.2018.07.010 XX RN [2] RP 1-184 RA Wang C., Li R., Quan S., Shen P., Zhang D., Shi J., Yang L.; RT "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays"; RL Anal. and Bioanal. Chem. 407:4829-4834(2015). RX DOI=10.1007/s00216-015-8652-z XX RN [3] RP 1-184 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2018). RX PCR=QL-ELE-00-031.pdf XX FH Key Location/Qualifiers FH FT STS 1..184 FT /standard_name="LAMP 184 bp amplicon" FT /note="element-specific LAMP assay" FT /target="Figwort Mosaic Virus 35S promoter (P-FMV)" FT primer_bind 1..19 FT /standard_name="Primer forward: P-FMV35S F3" FT /note="GTCAGGGTACAGAGTCTCC" FT /target="P-FMV" FT primer_bind join(complement(66..87),22..41) FT /standard_name="Primer: P-FMV35S FIP" FT /note="GCTGGAACAGTAGTTTACTTTGACCATTAGCCAAAAGCTACA" FT primer_bind 22..41 FT /note="ACCATTAGCCAAAAGCTACA" FT /target="P-FMV35S F2" FT primer_bind complement(42..65) FT /standard_name="Primer: P-FMV35S loop F (complementary to the sequence between F1 and F2)" FT /note="ATTGAAGATTCTTCATTGATCTCC" FT primer_bind complement(66..87) FT /note="GCTGGAACAGTAGTTTACTTTG" FT /target="P-FMV35S F1c (complimentary to FT F1)" FT primer_bind join(88..105,complement(145..168)) FT /standard_name="Primer: P-FMV35S BIP" FT /note="ACATGCATGGTCAGTAAGATTACTTTCAAAGATGCCCAC" FT primer_bind 88..105 FT /note="ACATGCATGGTCAGT" FT /target="P-FMV35S B1c (complementary to FT B1) (according to the sequence of the FMV genome the BIP primer is missing the TCA FT nucleotides in position 96-98 of the amplicon)" FT primer_bind 108..144 FT /standard_name="Primer: P-FMV35S loop B (complementary FT to the sequence between B1 and B2)" FT /note="GTTTCAGAAAAAGACATCCACCGAAGACTTAAAGTTA" FT primer_bind complement(145..168) FT /note="AAGATTACTTTCAAAGATGCCCAC" FT /target="P-FMV35S B2" FT primer_bind complement(167..184) FT /standard_name="Primer reverse: P-FMV35S B3" FT /note="GCTGCTCGATGTTGACAA" FT /target="P-FMV" XX SQ Sequence 184 BP; 67 A; 39 C; 36 G; 42 T; 0 other; gtcagggtac agagtctccn naccattagc caaaagctac aggagatcaa tgaagaatct 60 tcaatcaaag taaactactg ttccagcaca tgcatcatgg tcagtnngtt tcagaaaaag 120 acatccaccg aagacttaaa gttagtgggc atctttgaaa gtaatcttgt caacatcgag 180 cagc 184 //