European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


Only one hit for query 'ac:MON-89034-3'
ID   QT-EVE-ZM-018; SV 0; linear; genomic DNA; STS; PLN; 77 BP.
XX
AC   MON-89034-3;
XX
DT   01-APR-2009
DT   17-NOV-2010
XX
DE   Quantitative PCR method for detection of maize event MON89034
DE   (Savini et al., 2008).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MON89034 (MON-89034-3)
XX
RN   [1]
RP   1-77
RA   Savini C., Bogni A., Grazioli E., Munaro B., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line MON89034 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/68713
XX
RN   [2]
RP   1-77
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-018.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..77
FT                   /standard_name="PCR 77 bp_amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of maize event MON89034 and the maize host genome"
FT   primer_bind     1..27
FT                   /standard_name="Primer forward: MON89034 primer 1"
FT                   /note="TTCTCCATATTGACCATCATACTCATT"
FT                   /target="insert"
FT   primer_bind     30..47
FT                   /standard_name="RT-PCR probe: MON89034 probe"
FT                   /note="FAM-ATCCCCGGAAATTATGTT-MGBNFQ"
FT   primer_bind     complement(50..77)
FT                   /standard_name="Primer reverse: MON89034 primer 2"
FT                   /note="CGGTATCTATAATACCGTGGTTTTTAAA"
FT                   /target="3'-host genome"
XX
SQ   Sequence 77 BP; 23 A; 17 C; 8 G; 25 T; 4 other;
     ttctccatat tgaccatcat actcattnna tccccggaaa ttatgttnnt ttaaaaacca        60
     cggtattata gataccg                                                       77
//