An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-87427-7'
ID   QT-EVE-ZM-003; SV 0; linear; genomic DNA; STD; SYN; 95 BP.
XX
AC   MON-87427-7;
XX
DT   17-JUL-2012
DT   24-JUL-2015
XX
DE   Quantitative PCR method for detection of maize event
DE   MON87427(EURL GMFF, 2015).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MON87427 (MON-87427-7)
XX
RN   [1]
RP   1-95
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MON 87427 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2015).
RX   EURL_GMFF=EURL-VL-03-12-VR.pdf
RX   EURL_GMFF=EURL-VL-03-12-VM.pdf
XX
RN   [2]
RP   1-95
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2015).
RX   PCR=QT-EVE-ZM-003.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..95
FT                   /standard_name="PCR 95 bp amplicon"
FT                   /note="Event-specific RT-PCR";
FT                   /target="5' integration border region (IBR) between the insert of maize event MON87427 and the maize host genome";
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: MON 87427 primer 1"
FT                   /note="ACGGAAACGGTCGGGTCAAATG"
FT                   /target="5'-host genome"
FT   primer_bind     30..57
FT                   /standard_name="RT-PCR probe: MON 87427 probe"
FT                   /note="FAM-TCGGGACAATATGGAGAAAAAGAAAGAG-
FT                   TAMRA"
FT   misc_recomb     33..64
FT                   /note="Fragment of genomic DNA recombined during
FT                   insertion, possibly from Chr. 5"
FT   primer_bind     complement(72..95)
FT                   /standard_name="Primer reverse: MON 87427 primer 2"
FT                   /note="CCATGTAGATTTCCCGGTTTTCTC"
FT                   /target="insert"
XX
SQ   Sequence 95 BP; 42 A; 12 C; 26 G; 15 T; 0 other;
     acggaaacgg tcgggtcaaa tgnnnnnnnt cgggacaata tggagaaaaa gaaagagnnn        60
     nnnnnnnnnn ngagaaaacc gggaaatcta catgg                                   95
//