ID   QL-ELE-00-002; SV 0; linear; genomic DNA; STS; SYN; 215 BP.
XX
AC   ;
XX
DT   23-JUN-2009
DT   11-JAN-2018
XX
DE   Qualitative PCR method for detection of Neomycin phosphotransferase II gene
DE   (ISO/FDIS 21569:2005).
XX
KW   element_specific.
XX
RN   [1]
RP   1-215
RT   "Foodstuffs - Methods of analysis for the detection of genetically
RT   modified organisms and derived products - Qualitative nucleic acid based
RT   methods";
RL   ISO 21569:1-69 (2005).
RX   ISO=34614
XX
RN   [2]
RP   1-215
RA   Collection of Official Methods under Article 35 of the German Federal Foods Act;
RT   "Screening procedure for the detection of genetically modified DNA
RT   sequences in foods by identification of DNA sequences that frequently
RT   occur in genetically modified organisms";
RL   Food Analysis, L 00.00-31, Beuth, Berlin Koln (1998).
XX
RN   [3]
RP   1-215
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-ELE-00-002.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..215
FT                   /standard_name="PCR 215 bp amplicon"
FT                   /note="element-specific PCR"
FT                   /target="Neomycin phosphotransferase II (nptII) gene"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: APH2 short"
FT                   /note="CTCACCTTGCTCCTGCCGAGA"
FT                   /target="nptII"
FT   primer_bind     complement(195..215)
FT                   /standard_name="Primer reverse: APH2 reverse"
FT                   /note="CGCCTTGAGCCTGGCGAACAG"
FT                   /target="nptII"
XX
SQ   Sequence 215 BP; 48 A; 66 C; 61 G; 40 T; 0 other;
     ctcaccttgc tcctgccgag annnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
     nnnnnnnnnn nnnnctgttc gccaggctca aggcg                                  215
//