An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'id:QL-ELE*&ft:Cry1AC'
ID   QL-ELE-00-030; SV 0; linear; genomic DNA; STD; SYN; 197 BP.
XX
AC   ;
XX
DT   17-AUG-2009
DT   12-DEC-2017
XX
DE   Qualitative LAMP method for detection of Cry1Ac gene (Li et al., 2018).
XX
KW   element_specific.
XX
RN   [1]
RP   1-197
RA   Li R., Shi J., Liu B., Zhang D., Zhao X., Yang L.;
RT   "International collaborative ring trial of four gene-specific loop-mediated isothermal amplification assays in GMO analysis";
RL   Food Control 84:278-283 (2018).
RX   DOI=10.1016/j.foodcont.2017.08.012
XX
RN   [2]
RP   1-197
RA   Wang C., Li R., Quan S., Shen P., Zhang D., Shi J., Yang L.;
RT   "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays";
RL   Anal. and Bioanal. Chem.  407:4829-4834(2015).
RX   DOI=10.1007/s00216-015-8652-z
XX
RN   [3]
RP   1-197
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2017).
RX   PCR=QL-ELE-00-030.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..197
FT                   /standard_name="LAMP 197 bp amplicon"
FT                   /note="element-specific LAMP assay"
FT                   /target="Cry1Ac modified gene derived from Bacillus thuringiensis"
FT   primer_bind     1..18
FT                   /standard_name="Primer forward: cry1Ac F3"
FT                   /note="GAGGCCAAAGAGTCCGTG"
FT                   /target="cry1Ac"
FT   primer_bind     join(21..41,complement(68..87))
FT                   /standard_name="Primer: cry1Ac FIP"
FT                   /note="GGCGTGGATCATGGCGATGTTGCTTTGTTCGGGAACTCCC
FT                   A"
FT   primer_bind     21..41
FT                   /note="TGCTTTGTTCGGGAACTCCCA"
FT                   /target="cry1Ac F2 (in position 32 the sequence of the
FT                   amplicon includes an oligonucleotide T instead of
FT                   oligonucleotide G of the primer sequence)"
FT   primer_bind     complement(43..65)
FT                   /standard_name="Primer: cry1Ac loop F (complementary to the sequence between F1 and F2)"
FT                   /note="GTGTCGGCTTGCAACTGATCATA"
FT   primer_bind     complement(68..87)
FT                   /note="GGCGTGGATCATGGCGATGT"
FT                   /target="cry1Ac F1c (complementary to F1)"
FT   primer_bind     join(96..117,complement(157..174))
FT                   /standard_name="Primer: cry1Ac BIP"
FT                   /note="ACGTGTGCACAGCATTCGTGAGTTCCTCGAAGATGGCAGC
FT                   "
FT   primer_bind     96..117
FT                   /note="ACGTGTGCACAGCATTCGTGAG"
FT                   /target="cry1Ac B1c (complementary to B1)"
FT   primer_bind     127..148
FT                   /standard_name="Primer: cry1Ac loop B (complementary to the sequence between B1 and B2)"
FT                   /note="CCTGAGTTGTCCGTGATCCCTG"
FT   primer_bind     complement(157..174)
FT                   /note="TTCCTCGAAGATGGCAGC"
FT                   /target="cry1Ac B2"
FT   primer_bind     complement(178..197)
FT                   /standard_name="Primer reverse: cry1Ac B3"
FT                   /note="GCGGTAAAGATACGTCCCTC"
FT                   /target="cry1Ac"
XX
SQ   Sequence 197 BP; 45 A; 54 C; 51 G; 47 T; 0 other;
     gaggccaaag agtccgtgnn tgctttgttc gtgaactccc antatgatca gttgcaagcc        60
     gacacnnaca tcgccatgat ccacgccnnn nnnnnacgtg tgcacagcat tcgtgagnnn       120
     nnnnnncctg agttgtccgt gatccctgnn nnnnnngctg ccatcttcga ggaannngag       180
     ggacgtatct ttaccgc                                                      197
//