Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

Only one hit for query 'ac:ACS-OS002-5'
ID   QT-EVE-OS-002; SV 0; linear; genomic DNA; STS; SYN; 88 BP.
AC   ACS-OS002-5;
DT   22-JAN-2007
DT   17-NOV-2010
DE   Quantitative PCR method for detection of rice event LLRICE62
DE   (Mazzara et al., 2006).
KW   event_specific.
OS   Oryza sativa (rice) - event LLRICE62 (ACS-OS002-5)
RN   [1]
RP   1-88
RA   Mazzara M., Grazioli E., Savini C., Van Den Eede G.;
RT   "Event-specific Method for the Quantitation of Rice Line LLRICE62 Using Real-time PCR -Validation Report and Protocol - Sampling and DNA Extraction of Rice";
RL   Online Publication (2006).
RX   DOI=10.2788/31940
RN   [2]
RP   1-88
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-OS-002.pdf
FH   Key             Location/Qualifiers
FT   STS             1..88
FT                   /standard_name="PCR 88 bp_amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of rice event LLRICE62 and the rice host genome"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: MDB616"
FT                   /note="AGCTGGCGTAATAGCGAAGAGG"
FT                   /target="insert"
FT   primer_bind     25..54
FT                   /standard_name="RT-PCR probe: TM019"
FT   primer_bind     complement(68..88)
FT                   /standard_name="Primer reverse: MDB694"
FT                   /note="TGCTAACGGGTGCATCGTCTA"
FT                   /target="3'-host genome"
SQ   Sequence 88 BP; 22 A; 20 C; 20 G; 26 T; 0 other;
     agctggcgta atagcgaaga ggcccgcacc gattatttat acttttagtc cacctggttt        60
     ttattgatag acgatgcacc cgttagca                                           88