Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

Only one hit for query 'ac:ACS-OS002-5'
ID   QL-CON-00-002; SV 0; linear; genomic DNA; STS; SYN; 350 BP.
AC   ;
DT   05-MAY-2009
DT   05-OCT-2016
DE   Qualitative PCR method for detection of the junction between the polygalacturonase gene and the nos terminator(ISO/FDIS 21569:2005).
KW   construct_specific.
OS   Solanum lycopersicum (tomato) - event Nema282F
RN   [1]
RP   1-350
RT   "Foodstuffs - Methods of analysis for the detection of genetically
RT   modified organisms and derived products - Qualitative nucleic acid based
RT   methods";
RL   ISO 21569:1-69 (2005).
RX   ISO=34614
RN   [2]
RP   1-350
RT   "Detection of a genetic modification of tomatoes by amplification of the
RT   modified DNA sequence by means of the polymerase chain reaction (PCR) and
RT   hybridization of the PCR product with a DNA probe or restriction analysis
RT   of the PCR product, No. L25.03.01";
RL   Online Publication (1999).
RN   [3]
RP   1-350
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-CON-00-002.pdf
FH   Key             Location/Qualifiers
FT   STS             1..350
FT                   /standard_name="PCR 350 bp amplicon"
FT                   /note="construct-specific PCR"
FT                   /target="Junction region between the polygalacturonase (PG) gene copy from Solanum lycopersicum L. and the nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: PG34L"
FT                   /note="GGATCCTTAGAAGCATCTAGT"
FT                   /target="PG"
FT   primer_bind     complement(331..350)
FT                   /standard_name="Primer reverse: t-Nos"
FT                   /note="CATCGCAAGACCGGCAACAG"
FT                   /target="T-nos"
SQ   Sequence 350 BP; 7 A; 9 C; 12 G; 13 T; 309 other;
     ggatccttag aagcatctag tnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn ctgttgccgg tcttgcgatg                  350