Only one hit for query 'ac%3aMON-89034-3'
ID QL-CON-00-002; SV 0; linear; genomic DNA; STS; SYN; 350 BP. XX AC ; XX DT 05-MAY-2009 DT 05-OCT-2016 XX DE Qualitative PCR method for detection of the junction between the polygalacturonase gene and the nos terminator(ISO/FDIS 21569:2005). XX KW construct_specific. XX OS Solanum lycopersicum (tomato) - event Nema282F XX RN [1] RP 1-350 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Qualitative nucleic acid based RT methods"; RL ISO 21569:1-69 (2005). RX ISO=34614 XX RN [2] RP 1-350 RT "Detection of a genetic modification of tomatoes by amplification of the RT modified DNA sequence by means of the polymerase chain reaction (PCR) and RT hybridization of the PCR product with a DNA probe or restriction analysis RT of the PCR product, No. L25.03.01"; RL Online Publication (1999). XX RN [3] RP 1-350 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-CON-00-002.pdf XX DR GMOMETHODS; QL-TAX-SL-001; XX FH Key Location/Qualifiers FH FT STS 1..350 FT /standard_name="PCR 350 bp amplicon" FT /note="construct-specific PCR" FT /target="Junction region between the polygalacturonase (PG) gene copy from Solanum lycopersicum L. and the nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens" FT primer_bind 1..21 FT /standard_name="Primer forward: PG34L" FT /note="GGATCCTTAGAAGCATCTAGT" FT /target="PG" FT primer_bind complement(331..350) FT /standard_name="Primer reverse: t-Nos" FT /note="CATCGCAAGACCGGCAACAG" FT /target="T-nos" XX SQ Sequence 350 BP; 7 A; 9 C; 12 G; 13 T; 309 other; ggatccttag aagcatctag tnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 180 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 240 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 300 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn ctgttgccgg tcttgcgatg 350 //