ID QT-EVE-ZM-020; SV 0; linear; genomic DNA; STS; SYN; 92 BP. XX AC MON-00810-6; XX DT 29-MAY-2006 DT 10-JAN-2023 XX DE Quantitative PCR method for detection of maize event MON810. XX KW event_specific. XX OS Zea mays (maize) - event MON810 (MON-00810-6) XX RN [1] RP 1-92 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [2] RP 1-92 RA Mazzara M., Grazioli E., Savini C., Van Den Eede G.; RT "Report on the Verification of the Performance of a MON810 Event-specific Method on Maize Line MON810 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2009). RX DOI=10.2788/59036 XX RN [3] RP 1-92 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-020.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..92 FT /standard_name="PCR 92 bp amplicon" FT /note="Event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event MON810 and the maize host genome" FT primer_bind 1..24 FT /standard_name="Primer forward: Mail-F1" FT /note="TCGAAGGACGAAGGACTCTAACGT" FT /target="5'-host genome" FT primer_bind 27..49 FT /standard_name="RT-PCR probe: Mail-S2" FT /note="FAM-AACATCCTTTGCCATTGCCCAGC-TAMRA" FT primer_bind complement(69..92) FT /standard_name="Primer reverse: Mail-R1" FT /note="GCCACCTTCCTTTTCCACTATCTT" FT /target="insert" XX SQ Sequence 92 BP; 26 A; 18 C; 23 G; 25 T; 0 other; tcgaaggacg aaggactcta acgtnnaaca tcctttgcca ttgcccagcn nnnnnnnnnn 60 nnnnnnnnaa gatagtggaa aaggaaggtg gc 92 //