ID QT-EVE-ZM-025; SV 0; linear; genomic DNA; STS; SYN; 88 BP. XX AC MON-87403-1; XX DT 24-JUN-2015 DT 07-MAY-2018 XX DE Quantitative PCR method for detection of maize event MON 87403 (EURL GMFF, 2018). XX KW event_specific. XX OS Zea mays (maize) - event MON87403 (MON-87403-1) XX RN [1] RP 1-88 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize MON 87403 Using Real-time PCR - Validation Report"; RL Online Publication (2018). RX EURL_GMFF=EURL-VL-02-15-VM.pdf RX EURL_GMFF=EURL-VL-02-15-VR.pdf XX RN [2] RP 1-88 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2018). RX PCR=QT-EVE-ZM-025.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..88 FT /standard_name="PCR 88 bp amplicon" FT /note="Event-specific RT-PCR"; FT /target="3' integration border region (IBR) between the insert of maize event MON87403 and the maize host genome"; FT primer_bind 1..30 FT /standard_name="Primer forward: 87403 QF" FT /note="CTTTCTTTTTCTCCATATTGACCATCATAC" FT /target="insert" FT primer_bind 31..58 FT /standard_name="RT-PCR probe: 87403 QP" FT /note="FAM-TCATTGCGATCCACATTTCCCTACATGG-TAMRA" FT primer_bind complement(64..88) FT /standard_name="Primer reverse: 87403 QR" FT /note="TACTCCGGAATGAGTGCTCTGTATC" FT /target="3'-host genome" XX SQ Sequence 88 BP; 21 A; 24 C; 14 G; 29 T; 0 other; ctttcttttt ctccatattg accatcatac tcattgcgat ccacatttcc ctacatggnn 60 nnngatacag agcactcatt ccggagta 88 //