An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'id:ql-ele*&ft:'e9''
ID   QL-ELE-00-024; SV 1; linear; genomic DNA; STD; PLN; 87 BP.
XX
AC   ;
XX
DT   20-FEB-1985
DT   22-DEC-2016
XX
DE   Qualitative PCR method for detection of tE9 terminator (Debode et al., 2016).
XX
KW   element_specific.
XX
RN   [1]
RP   1-87
RA   Debode F., Huber I., Macarthur R., Rischitor P.E., Mazzara M., Herau V., Sebah D., Dobnik D., Broeders S., Roosens N.H., Busch U., Berben G., Morisset D., Zel J.;
RT   "Inter-laboratory studies for the validation of two singleplex (tE9 and pea lectin) and one duplex (pat/bar) real-time PCR methods for GMO detection";
RL   Food Control 73:452-461 (2017).
RX   DOI=10.1016/j.foodcont.2016.08.037.
XX
RN   [2]
RP   1-87
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2016).
RX   PCR=QL-ELE-00-024.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..87
FT                   /standard_name="PCR 87 bp amplicon"
FT                   /note="element-specific PCR"
FT                   /target="Terminator of the pea ribulose-1,5-bisphosphate carboxylase small subunit (rbcS) E9 gene"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: T-E9-R"
FT                   /note="TTTTTATTCGGTTTTCGCTATCG"
FT                   /target="T-E9"
FT   primer_bind     complement(25..60)
FT                   /standard_name="RT-PCR probe: T-E9-P"
FT                   /note="FAM-
FT                   TCATTAACTCTTCTCCATCCATTTCCATTTCACAGT-TAMRA"
FT   primer_bind     complement(62..87)
FT                   /standard_name="Primer reverse: T-E9-F"
FT                   /note="TGAGAATGAACAAAAGGACCATATCA"
FT                   /target="T-E9"
XX
SQ   Sequence 87 BP; 23 A; 10 C; 20 G; 34 T; 0 other;
     tttttattcg gttttcgcta tcgaactgtg aaatggaaat ggatggagaa gagttaatga        60
     atgatatggt ccttttgttc attctca                                            87
//