ID QT-EVE-ZM-017; SV 0; linear; genomic DNA; STS; SYN; 111 BP. XX AC REN-00038-3; XX DT 09-MAR-2006 DT 27-OCT-2010 XX DE Quantitative PCR method for detection of maize event LY038 DE (Charles Delobel et al., 2008). XX KW event_specific. XX OS Zea mays (maize) - event LY038 (REN-00038-3) XX RN [1] RP 1-111 RA Charles Delobel C., Grazioli E., Larcher S., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Maize Line LY038 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/43570 XX RN [2] RP 1-111 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-017.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..111 FT /standard_name="PCR 111 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event LYO38 and the maize host genome" FT primer_bind 1..21 FT /standard_name="Primer forward: LY038 AF" FT /note="TGGGTTCAGTCTGCGAATGTT" FT /target="5'-host genome" FT primer_bind 61..84 FT /standard_name="RT-PCR probe: LY038 AP" FT /note="FAM-CGAGCGGAGTTTATGGGTCGACGG-TAMRA" FT primer_bind complement(87..111) FT /standard_name="Primer reverse: LY038 AR" FT /note="AGGAATTCGATATCAAGCTTATCGA" FT /target="insert" XX SQ Sequence 111 BP; 22 A; 22 C; 37 G; 30 T; 0 other; tgggttcagt ctgcgaatgt tnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 cgagcggagt ttatgggtcg acggnntcga taagcttgat atcgaattcc t 111 //