ID QT-EVE-ZM-016; SV 0; linear; genomic DNA; STS; SYN; 95 BP. XX AC MON-88017-3; XX DT 11-JAN-2006 DT 05-NOV-2010 XX DE Quantitative PCR method for detection of maize event MON88017 DE (Charles Delobel et al., 2008). XX KW event_specific. XX OS Zea mays (maize) - event MON88017 (MON-88017-3) XX RN [1] RP 1-95 RA Charles Delobel C., Foti N., Grazioli E., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Maize Line MON 88017 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/43272 XX RN [2] RP 1-95 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-016.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..94 FT /standard_name="PCR 94 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of maize event MON 88017 and the maize host genome" FT primer_bind 1..20 FT /standard_name="Primer forward: MON88017 AF" FT /note="GAGCAGGACCTGCAGAAGCT" FT /target="insert" FT primer_bind 47..75 FT /standard_name="RT-PCR probe: MON88017 AP" FT /note="FAM-TCCCGCCTTCAGTTTAAACAGAGTCGGGT-TAMRA" FT primer_bind complement(77..94) FT /standard_name="Primer reverse: MON88017 AR" FT /note="TCCGGAGTTGACCATCCA" FT /target="3'-host genome" FT misc_difference 94 FT /note="There is a mismatch between the sequence 'T' of FT the rev-primer MON88017 Primer 2 and the reported genomic FT sequence 'C'of MON88017. According to Monsanto this does FT not have a bad influence on the PCR and the method has FT been validated." XX SQ Sequence 94 BP; 20 A; 21 C; 29 G; 24 T; 0 other; gagcaggacc tgcagaagct nnnnnnnnnn nnnnnnnnnn nnnnnntccc gccttcagtt 60 taaacagagt cgggtntgga tggtcaactc cggc 94 //