Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:SYN-IR102-7'
ID   QT-EVE-GH-012; SV 0; linear; genomic DNA; STD; SYN; 101 BP.
XX
AC   SYN-IR102-7;
XX
DT   10-OCT-2016
DT   20-MAR-2020
XX
DE   Quantitative PCR method for detection of cotton event COT102 (EURL GMFF, 2020).
XX
KW   event_specific.
XX
OS   Gossypium hirsutum (upland cotton) - event COT102 (SYN-IR102-7)
XX
RN   [1]
RP   1-101
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Cotton COT102 Using Real-time PCR - Validation Report";
RL   Online Publication (2020).
RX   EURL_GMFF=EURL-VL-05-16-VR.pdf
RX   EURL_GMFF=EURL-VL-05-16-VM.pdf
XX
RN   [2]
RP   1-101
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2020).
RX   PCR=QT-EVE-GH-012.pdf
XX
DR   GMOMETHODS; QT-TAX-GH-022;
DR   GMOMETHODS; QT-TAX-GH-017;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..101
FT                   /standard_name="PCR 101 bp amplicon"
FT                   /note="Event-specific RT-PCR";
FT                   /target="3' integration border region (IBR) between the insert of cotton event COT102 and the cotton host genome"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: COT102_3_89F"
FT                   /note="TCTCCGCTCATGATCAGATTGTC"
FT                   /target="insert"
FT   primer_bind     27..59
FT                   /standard_name="RT-PCR probe: COT102_3_115T"
FT                   /note="FAM- TCCCGCCTTCAGTTTAAACTATCAGTGTTTAAT-TAMRA"
FT   primer_bind     complement(77..101)
FT                   /standard_name="Primer reverse: COT102_3_181R"
FT                   /note="CAGTAACAGTACAGTCGGTGTAGGG"
FT                   /target="3'-host genome"
XX
SQ   Sequence 101 BP; 23 A; 26 C; 16 G; 36 T; 0 other;
     tctccgctca tgatcagatt gtcnnntccc gccttcagtt taaactatca gtgtttaatn        60
     nnnnnnnnnn nnnnnnccct acaccgactg tactgttact g                           101
//