ID QL-CON-00-014; SV 1; linear; genomic DNA; STD; SYN; 170 BP. XX AC ; XX DT 22-DEC-2008 DT 08-JUN-2017 XX DE Qualitative PCR method for detection of the junction between the nos promoter and the neomycin phosphotransferase II gene XX KW construct_specific. XX OS Carica papaya (papaya) - event Sunup-Papaya 55-1 XX RN [1] RP 1-170 RT "Horizontal methods for molecular biomarker analysis -- Methods of analysis for the detection of genetically modified organisms and derived products - Part 4: Real-time PCR based screening methods for the detection of the P-nos and P-nos-nptII DNA sequences"; RL ISO/TS 21569-4:2016 (2016). RX ISO=69339 XX RN [2] RP 1-170 RT "Detection of a DNA sequence junction between the nos-promoter and the nptII-gene for screening of genetically modified organism using real-time PCR"; RL BVL L 00.00-142:2013-01 Food Analysis, Beuth, Berlin Koln (2013). RX BVL=bvl-l-00-00-142/179718833 XX RN [3] RP 1-170 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2017). RX PCR=QL-CON-00-014.pdf XX FH Key Location/Qualifiers FH FT STS 1..170 FT /standard_name="PCR 144-170 bp amplicon" FT /note="Construct-specific RT-PCR" FT /target="Junction region between the nopaline synthase promoter (P-nos) from Agrobacterium tumefaciens and the neomycin phosphotransferase II (nptII) gene" FT misc_feature 1..170 FT /note="The fragment size generated by the P-nos-nptII PCR depends on the assembly of the two sequence elements and is varying in the different GM plant events" FT primer_bind 1..22 FT /standard_name="Primer reverse: nptII-R" FT /note="GATTGTCTGTTGTGCCCAGTCA" FT /target="nptII gene" FT primer_bind 24..48 FT /standard_name="RT-PCR probe: nptII-Tm2" FT /note="FAM-AGCCGAATAGCCTCTCCACCCAAGC-BBQ" FT primer_bind complement(148..170) FT /standard_name="Primer forward: pnos-F2" FT /note="TTCCCCTCGGTATCCAATTAGAG" FT /target="P-nos" XX SQ Sequence 170 BP; 47 A; 34 C; 50 G; 39 T; 0 other; gattgtctgt tgtgcccagt catagccgaa tagcctctcc acccaagcgg ccggagaacc 60 tgcccggatc cgggcggaaa taggtaaaga agttgcggat aaggtaattg ccattgcaga 120 ttatttggat tgagagtgaa tatgagactc taattggata ccgaggggaa 170 //