ID QT-EVE-ZM-004; SV 0; linear; genomic DNA; STS; SYN; 98 BP. XX AC DAS-40278-9; XX DT 15-NOV-2010 DT 23-AUG-2013 XX DE Quantitative PCR method for detection of maize event DAS-40278-9 (Savini et al., 2012). XX KW event_specific. XX OS Zea mays (maize) - event DAS-40278-9 (DAS-40278-9) XX RN [1] RP 1-98 RA Savini C., et al.; RT "Event-specific Method for the Quantification of Maize DAS-40278-9 by Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7"; RL Online Publication (2012). RX DOI=10.2788/64013 XX RN [2] RP 1-98 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2012). RX PCR=QT-EVE-ZM-004.pdf XX DR GMOMETHODS; QT-TAX-ZM-002; XX FH Key Location/Qualifiers FH FT STS 1..98 FT /standard_name="PCR 98 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5'integration border region (IBR) between the insert of maize event DAS-40278-9 and the maize host genome"; FT primer_bind 1..22 FT /standard_name="Primer forward: DAS-40278-9_5'-f1" FT /note="CACGAACCATTGAGTTACAATC" FT /target="5'-host genome" FT primer_bind complement(43..67) FT /standard_name="RT-PCR probe: DAS-40278-9_5'-S2" FT /note="FAM-CGTAGCTAACCTTCATTGTATTCCG-TAMRA" FT primer_bind complement(76..98) FT /standard_name="Primer reverse: DAS-40278-9_5'-r3" FT /note="TGGTTCATTGTATTCTGGCTTTG" FT /target="insert" XX SQ Sequence 98 BP; 39 A; 23 C; 18 G; 18 T; 0 other; cacgaaccat tgagttacaa tcnnnnnnnn nnnnnnnnnn nncggaatac aatgaaggtt 60 agctacgnnn nnnnncaaag ccagaataca atgaacca 98 //